Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

Oligo: sjj_C30B5.1_b   

sjj_C30B5.1_bSequenceCGAACTCGCCAGTGTTGTAA
PCR_productsjj_C30B5.1