Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_C30F12.1   

sjj_C30F12.1 RNAi (8)
PCR_productsjj_C30F12.1
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSC30F12.1 Source_evidenceePCR607WS150 Sequence/Annotation Release
Overlaps_Gene C30F12.1 Source_evidenceePCR607WS150 Sequence/Annotation Release
Chunk_score Abs_score523
Max_abs_score523C30F12.1
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI69593426961032
Overlaps_transcriptC30F12.1 Source_evidenceePCR607WS150 Sequence/Annotation Release
WB_DNA_textsjj_C30F12.11691tttttctaccatttgttttgcgtcaacttacaacattgcaacatttgatccatcaacaaccacagctctcaaacttggatccgggttgtatttggatggtgtggatgatgacgtggcaggtgatgacgtggcaattgatactgattgtctaataggacgatgacttgacgatgatgaggcagaagaagacgatgcagaggaagtcatgattggttcaggagaatttctacttccagattttccagaattttctggtttaccaccaggaagacccatttttacaagttctgagagcacgtcgtcctgaaatttttttagttttgtttgacaatattcgaatcaaatttatgaaatttcaattgaatactgttatttttgatttttggtgagacatttccaacttttcgcaatttactagaaaatctgaaaactattttccttaaattgtcgtatagtgtttttaaagtcacaaacatgttctaatttaaatatttttctgaagtaataaacacgaaccattctagaatcaacaccaattgtattcaatacgtgacttagttgctctgtcgaatatcccaatttcgtggcgaattcaacaacttccggtgctggatatcttatcattggcgctgtttggtcatctgagatttaagagcaaatataattttgttgaaaatattaaataaaaatcagggatctttgaaattatctaaaataattgtttcctactaaccatcaattttgcttggatccgatgattcgcgactcagtgatggatgggatatatcgtcgcaagaactgcaaaaaaacaatggtaaaaaatttgaattgaaacttttttgagattgctgaaatgtttaatgttataaatatttatgtgcatccaaactcaatccaaactcataaaaagtgactagaaagctcaaaagttatttctctgaaaacaaattaaactgcaaaaaaaacctccaaggattgaaaaaagaagacctacagaaaaatgagaacaaaatttccggctgatggaaaaaaagaaaaaatatgaaaaatatgcgaaagaaatgcacgttgtctgtttccgggatagttattttcagtcatttacagaggttttatcatattttttccttatactcttaatttaatttgccatcatttgtactgaaaattatttttaacggaagtgcatgtgggtgacgatttacaaacagaaatgcaaggttcaacttctcgaagcttttttgcaggaactctgcgaaaaaattttttacgatggccaaataaatttgtcattgaattttaacatccaaaacaagagcataattaaaaaccttttcaaaaacttcgaaggtataaattatttgcaaatcagttgaatatttatatgtatttttactaattttgaattaccatttcttaaaatgtaattccgtagatttgtcgagaacaagccatctctccccatgatttcaactgaataatttcagactaaattaattttttgaaatttttttctctctgcactttatctgaaaacataacaaacctgtaacaagagtcaaaatcattgcattgaactggagccaatcctggcggtggtccagttgaaagcacctgcccagaacttccaataatttgagcatttccttgttctccgtaggagccaattggatttgacattgattgtacca