Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_C30F12.2   

sjj_C30F12.2RNAiJA:C30F12.2
PCR_productsjj_C30F12.2
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_Gene C30F12.2 Source_evidenceePCR799WS150 Sequence/Annotation Release
Chunk_score Abs_score673
Max_abs_score673C30F12.2
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI69690626970214
Overlaps_transcript C30F12.2.2 Source_evidenceePCR754WS150 Sequence/Annotation Release
C30F12.2.1 Source_evidenceePCR799WS150 Sequence/Annotation Release
WB_DNA_textsjj_C30F12.21153acatgatttccgtctccagctgcactgcgacggtaatccattccagaatccaaagcaagagatgcacatttatcctgcgaaactttaaaatttccgtatactttaacaaaaaattacttctaaaatagtgatgaaaggcatgaactgatgtcgctgaagaccatttttgtaaagttctgaaggtgctcgatttgaagttgcaaccattacaagaccacgatcaaataacattgagaagaatcgttttagaatcattgcgtcggcaatatctgtgacctgcaaaacaaaatttacacaaaaatattaactaatttgaaatcttttaaatttaaatatcgacataattgttttttctgaaattttgttattcaacctcaagctcacctgaaactcatcaaaacacaataaattcgtcgtttccataatttcatcgacaataactggtacaggatcaaattttccacgagctttattactctgcattttgagttcgtgcattcctggaaaacatatttcgataatttatgctacaatcaaataatacaaacttttatgtacattttgcataaaatcattaaaatgaacccgtcgttttttatctatcggacaattttcaaaaaataaatccatgagcattgttttcccgcatccaactgaaccatacaagtaaattccacgtggtgatataatttttggagtatccttaaggagcacaattatttgaatattttcgaaatatagtttgtcaaatttccaaaacttcaaaatattaattgcgaaaacttactactttagaattttgaaacattttccagaatcttgaacttgatttttctgatatattagacttgttcgttggttgatatgattcgatttctttccgcaatcgttcgaaatcaacaatcatttttctctgaaatttttttttaattttgaaacattttccaaaaaaatttacctgataatcgtcttctttaagtgtcccttcgtttacttttttcgagtacgcatcgcttaatgtgactaaaaaccgttgaacttgcagatattgtaattttgagcgaattggggagagcatttcagctgtaaaagattttcgaataaattcttggttcaaaaatcactgataagatattatcacaacggactgggc