Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_C30F12.4   

sjj_C30F12.4RNAiJA:C30F12.4
PCR_productsjj_C30F12.4
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSC30F12.4 Source_evidenceePCR741WS150 Sequence/Annotation Release
Overlaps_Gene C30F12.4 Source_evidenceePCR852WS150 Sequence/Annotation Release
Chunk_score Abs_score747
Max_abs_score747C30F12.4
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI69723076973754
Overlaps_transcriptC30F12.4 Source_evidenceePCR852WS150 Sequence/Annotation Release
WB_DNA_textsjj_C30F12.41448tgggaaattggtgccataataaagaaaaatatatactattttcaaacaagacatgtttcaaattcacaatttaactgcattcactttggtttttgcgttcttccttccacggtgcccatattttttgccacaggctccacaagcgtcaacgtagttgcaacaaatgcaaatgagtgggagacaacatgtcagaggacagcagcacacggcaaggcacatcaaaatcttctaaaaattattaaaactttaaaaataaaatttttaaagtgtgatagtttcgaccttcgaagttatcatgtaaatcagctatttataatattttcgtttctgactatcaaaatcatctcgttgcactttaaaaataatcagcaaaaatgactaacctttctcaatcgatcttgttttcgcatgatgattccttttcgacatttcggacagacgagtgcacccacacctcctccgggagatccaccaatttgtggagactggttaacgcacagagttatagctgaaattttaagataaataaaagaagaagtggaaatttctactttttgatgattaaaaaaaggtgaatggcaacttgaaattatgaataaaaataaatttgtctagactaggtctcacaaattggacatccggttttttgagttctaattttgtgttcgagcgctttttttctcgatgtctgagactggatttcaataaaaaacaaggagtatcgagtattttataaaaatgaagtttcgccgaaacatatatatatatcttgtataatttttttataatttttaatattacttatcgaatatacctggcgacgcctgctgttgcggtggggcttggacaggcggttgaggtgagacaagctgcactggattggccatttgagccatctgagtcatcatcatctgtggtcctgcagttgtcatgatcggttgctgcataacaatttgctgaggcatcatttgagccatttggggcatcatgtactgctgttgaaccattggcattgaaactggaaccatttgaggctgtggttgaattggtggagcagatggaactgatggatagacttgagatgaataatatggtggcggttgttgttgagaatattgagaaatcctgtaaattgtgaatttattccaatgaattttctttcttcaactcactctggtctgatatgttgccgcataacctccactcttcgtggagaaatgtacttgacagtttcgggccccaaaaattgaactcttccatcaggcgtgagtgggggctcttcatctgaaaattaggtgtttaaaatttttagattattttataaaataacttacagacgtaatcagtcggattaattgtcatcttgagcaacgattttccgattgaaaacagatgagaaaataaaaaaaaataattcctcgaatctcagtctgtgagaagtgcgtcga