Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_C30F12.6   

sjj_C30F12.6RNAiJA:C30F12.6
PCR_productsjj_C30F12.6
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSC30F12.6 Source_evidenceePCR758WS150 Sequence/Annotation Release
Overlaps_Gene C30F12.6 Source_evidenceePCR918WS150 Sequence/Annotation Release
Chunk_score Abs_score813
Max_abs_score813C30F12.6
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI69903556992000
Overlaps_transcriptC30F12.6 Source_evidenceePCR918WS150 Sequence/Annotation Release
WB_DNA_textsjj_C30F12.61646ccatgtgcactgttaaacgcgcaacgtgtattatctgtggtatctggatcttctcaatgctgtatcattcctattggcttttcttggctacgttaatcaaagatgatattggaacatcttgtagttttcggttggaaagaaatagtcatgcttacaaggtaaacgatattatatttcagtttttttgttttccacttttaactttatccatgtcaatttataaatagaataactttataatttttactttttcagatagttttccttcttgatttcgtcctgtggtacgtgcttccaattatgtgcgacatcattatctacgcaaaaatcggtatcactttgagtcaatgtggagataagattaagaaatcggtgaagccgaaaagtaacataactactaataattctcatcacaaaacaatgaggtttagaaatttcagtaccaaatgaagtgatcgtcgaaaaatcaaagacatcgtcgacttcaatgggacattattccggaagagattctcatatttcggggaaacggaactcggcaaaaggaagaaatcaggtgggatcaagtttataatcctccctttttatttatttactttcccaaatgttcttggatttgtggtgtgagggttcacaattttttttggaaaaaaactgaacaaataaaataacattttcaggttgtaaaaatgcttgcaatcgttgtggccgtcttcgcagtgtgttggcttccttatcgtggaatggttgtctataattcatttgtatcggatccaaagtattcatggagtcctgattggtatatcaatttgtcaaagacacttgtattcatcaactgtgctattaatccaatactatacaacttgatgtctgctagattccgtgctgcattcagatcgttgttatcgaaaagaaagaattccggatttaaatgtgagtttttagtttgaccagctaaatgggtatttttttaaagaaaattattggtaattaaaatcaataatttcgattcagtgtgatcccacttaaattttatacattgtttttaaaagaaatgtgtccacagtttaaataattgatcactttttagaacatttcaagaaaaacgtatttcatgttccaaaaatggtaattttcaaccagctcgtgcctttgcaccgacgaaacttatcagctaccatactcacaagtattgtgcattttccgcttactcttctcagtttacttgagctttttatcagaaagttaaagaaaatgtgtggtataaactgataaaagtctactttcggttacagtaattttgctcgtagactcaaagctgtgattcgaaaaatttatctttttgatcaaaaactttgattatgacaaacctgatacattttcagcaacagctttgaaccaacgtcaccgattaaacacaatggatataatgtcatcagctgaaccaaaatctccattaataacatcaatggctggaactccgtgatacatttctcttattccttcaaattatctccttctcatcatagtgttgcctttaatttttatttatgggttcaaatttcgccaatttttaaataattatgtacagtatgtttttttctccctgaacttctcatcattttacaaccgggtaaaagcacatt