Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_C30F12.7   

sjj_C30F12.7RNAiJA:C30F12.7
PCR_productsjj_C30F12.7
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSC30F12.7 Source_evidenceePCR819WS150 Sequence/Annotation Release
Overlaps_Gene C30F12.7 Source_evidenceePCR819WS150 Sequence/Annotation Release
Chunk_score Abs_score714
Max_abs_score714C30F12.7
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI69758966976954
Overlaps_transcriptC30F12.7 Source_evidenceePCR819WS150 Sequence/Annotation Release
WB_DNA_textsjj_C30F12.71059acaaaacacgacgatccacaattcaactctcgtaacgttgaactcagaactaaattggatctctatgccaatattcttcactgtgtcacaattccaacagtacctaccagacattctgtaagtaaacttaccaatttgtttcagttggagagtttaaaaaaattgtattcaattgttaaaacttcttatttttaagggaattgatattgttcttatacgtgaaaatacggaaggagaatactctggattagaacatgaagcagttccaggaatcgtagaaagcattaaagtgagttcaaattcctactttcctgtattttcagttaaataaatactttgagatcgtcacccgtgagaaaattgagagaatctcaagaatggcatttgaatatgcaaaagcaaatggaagaaagaaggttacagctgttcataaagctaatattcagaaacttggagatggacttttcctaaaggtgtgtttttaacgtttcaatttaaggcctaaaataatgaatattaaatgatatttcaggttgttcgggacatgtcagaagattataaggatatcaaatttgaagcaatgattgtggataatgcctcaatgcaacttgtctctaaacctcaacagttcgatgtaatggttatgccaaatctttatggaaatatcatttcgaacattgcatgtggccttgtcggtggacctggattagtgtctggaatgaatcttggagataaatatgctgtttttgaaacaggaactcgtaatactggaacttctcttgctggaaaagatattgccaatccaactgcgttcattcgagcatctgttgatatgttgagatatttgggatgccattatcacgctaatattatttccgatgcattgtggaaggctcttgttgaacaaagaattcacactgctgatattggaggaaataattcggtaagtaaaattaaatagtttccaaaaaaaaacctaaaccattgttacaggccagtgatgttatcaacgcaactcttcagaacatcaaagttttgatggacgagaacccaaaacat