Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_C30H7.1   

sjj_C30H7.1RNAiJA:C30H7.1
PCR_productsjj_C30H7.1
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSC24A11.9 Source_evidenceePCR307WS150 Sequence/Annotation Release
Overlaps_Gene C24A11.9 Source_evidenceePCR401WS150 Sequence/Annotation Release
Chunk_score Abs_score317
Max_abs_score317C24A11.9
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI54150825416079
Overlaps_transcriptC24A11.9 Source_evidenceePCR401WS150 Sequence/Annotation Release
WB_DNA_textsjj_C30H7.1998tacaagcatttcccataagaagcgatacagtcggccgtaacatttttccaccctgaaattttcaatgtctatgagttggaaaaatatatttttagaaacctgttgaaaataataatgtgtcattcgtcctaaattcgatgtaacattcaagtctgctagattttcaacggcacccgattcatcctgtggtattagttgtaccattatatcgttctgaaatttcagttttttggttaaacttttattgaatttagtgaattataaacctgcatttgtctaacatgttcctgcacgaaagctgttgaagcaacactattatctgatgaggatgtagatgttgatgtggctgccattgaacattttctgcaatttttttttgaatttcggaaatttaaaatttcaaaagttgttacctgaactgccttgcgacaatattgattttcggtagaacacccataattatcttctattcttgattctttataccagtttttgtttctttcagtgctcaaaaactagtttcaccggcggctcatgtgggtttaggaggtctgaaagtgaatgaagataagttttttgaaaagtgaatgatgcaaattgaggcttctgagaatgccaaaagagtcattgataacagatataactgtccattcaggagaggaaacagctgataattgaaattcgcattaaagatgtgattgacgtgattaaaagtaaaaaggagtatagttataaccgagaattttgaataaattatattattatagcctaaacactttgaaaatgccaatgaaaattttggagtaattttgagaggaactttattttaataatatctctgattttttttcaatgttagattggtaaataattttttggattagaaaagaaaatatagaaaccaggaactagtttttatattttttttatttgccaaattttgaattgaattcaattttatatacactgattgattcaagcaaccagtgtacttctca