Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

Oligo: sjj_C31C9.1_f   

sjj_C31C9.1_fSequenceGTCCTGCATTACACTATCACGGT
In_sequenceSUPERLINK_CB_II
PCR_productsmd_C31C9.1:2