Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

Oligo: sjj_C31E10.7_b   

sjj_C31E10.7_bSequenceTAAGATAATGCCCCAGTTTTCAA
PCR_productsjj_C31E10.7