Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_C31H2.3   

sjj_C31H2.3 RNAi (5)
PCR_productsjj_C31H2.3
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSC31H2.3 Source_evidenceePCR602WS150 Sequence/Annotation Release
Overlaps_Gene C31H2.3 Source_evidenceePCR602WS150 Sequence/Annotation Release
Chunk_score Abs_score497
Max_abs_score497C31H2.3
Specificity_index1
Rel_score1
Map_statusUnique_ePCRX51517345154468
Overlaps_transcriptC31H2.3 Source_evidenceePCR602WS150 Sequence/Annotation Release
WB_DNA_textsjj_C31H2.32735aggcatagatcattgacaccagtgacatgatcgtccccaatatctgaatccatgcttggcatcttgattatgttgtcctcttggaacgtgcgtaaaagtcgtttatcgttagttttcagctcaacgcatgaacgagtttttccaagatctccaagtttcatatgtttcttcacgtttggacgctcaccgatactatcgaaagtagctgaaatagaatttccaagtctcggttggctgctaacattgtgtgcggatcacttacgatgctcaggaattgagctcactgagcactggcttttcggagagctatcgctgctgtccttcttacggctcgccatgctgttgagtttcttgcgaatgtcgaactcgctcgaagactttggcatcactgaaaatatcacaaatatcactaggaatagttgaaatgaagctcctggttagctaaaaagttaatcacttaaaaacatggaaaacgaatatagcgcggttcagacatcttgatagttttccttgctaataatcaccaagtaacatgtgagggtggaaaaaaaaagaagatttccgttttgattttgaattgcttcgtggtgttttaagaaccggaaataaaacaggaaattgaattgaacaaaaaaattgagtcaaaacatctgacacatttgtgagtttgatactatcaaatttagaggtttaacggtacggagccttagagtaccgaaatctgagactttagacttttagacccaaaatcgccccttaatacctaatttcgtaaggaaacatttcgaaaatcattttttggtgtaaattttgtcggttcaaagttttggaaaaggcaggttttcaactaatcgctcaatttttttctaaaactgtgaactgccaaaacttttttaaaaaaatttccagaacgtctcattgccaaactcggtagttttgagctaacgtggagtttaaaataggctaagattttggtatttcacctttaattctgaagaaaaaagctaaataatgaaaaataaaagagaaaacctatgtgatattctgttagaagaaacaaacaagcagttgtgaaggcagcgagctgtctcttcccctatattttcctatcttctcattgaaaccgtctaattagcgtgggagaatgtacatggtgatatttcacgaaaagtaggagacggaaattggaaataacaaaaaacatagaaaaaactatacctctgtcgatttcagtcttatcgagaagagtaactcgcgcttttctgttgaaaccacggtggggagcaattgggctactgccctccatttgtatgtcacctgaaaatgataaatgatcgaataggagtgaagatattatgtcatatgtcagcctgaatcaggtgacaacgtcgcattacacgcgtattcaaaacactaatgagtcaaccaagagcagcgccctttcgtaaagtctacatcgcatattcaaaagtctattcaatagtttataataaactaaaaaatgtcgcccgtatttggaaatcgtcgtgtaaataagatataagaagccatttttgtcaattttttctgttttcttggtttaggttgttcttgaaaaacaattgcactaataatactcaaaatgatgatgatgctcaacgaaaatgttgagatgtatattttcaatcttgaattctcatcctaaatatcaaattcgtaagaacaaaactagaaataggtaatcatatagtaaactacattttgaagagaaaagatgctgagggctacgtaatagtcaggtttgctatgatatttatacgctattcgcttgttcgtcacagcattcatttcgaacctcacacggattatctcctctttaacaatagcttgttatctcctgaataagtgagaaatgtgctcagcgttcatcgctcattgctcttgtgaagaaaacacctcaatttggggtagacaagggatcaatgaatatcaaatgtcaagtgtatagcaaattgaagaggctattctaagattagatttagcctctaaaaatagtaccatgtgactaatatctaaaaaccttcaactttattactaaactgaacccttatacaagcttttgtggccaattcaattttaaatgttacttaggcaatcactcgctgaaaggcatgttgctgtcactctttcagcacaatcgtgaacgatgataatacatttctgcattccaacaatgaaatcccgtacgccaacactgcctgaaaatggaaaatcacatattagttagaaacctgtattttttatcttctatttgcagtcaaacctaggctttctatgcaggcgacgatatgcctgccgtgcttcccttccggcgacccccgcaagcccaaaaaaagtcgggtgctgcaaaacatatacccaacgcacgtgaaaacaaaacgtgcaaaaaaataaagaatggaggtcagcagattgcaggcaggctccaaatacaagtctgtgtttcttattgttcctacacaattaaacctttttgttcaaaatcctattaaactaaaaaatgacatcacctacttattataatttaacttacgatttcttttagctgggaactttggcgggcgaccttgtggggtcaaacttcttctgctcatatcaatctgaaaattaactgtttcaatttgcaatggccgattttgctagcaatgcggccattgtgcatccagaatggacgatgctcaattcatgaaaacaca