Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_C31H5.5   

sjj_C31H5.5RNAiJA:C31H5.5
PCR_productsjj_C31H5.5
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSC31H5.5 Source_evidenceePCR472WS150 Sequence/Annotation Release
Overlaps_Gene C31H5.5 Source_evidenceePCR472WS150 Sequence/Annotation Release
Chunk_score Abs_score409
Max_abs_score409C31H5.5
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI90484109049345
Overlaps_transcriptC31H5.5 Source_evidenceePCR472WS150 Sequence/Annotation Release
WB_DNA_textsjj_C31H5.5936tggtgcatttagatggaattcttggattacaacaattaaaacgatgaagctttgaacacaatgaactattagcatttggtgctccaggaattggtggaagaagatcaagatcatctgatagagaatcatcattgtctagatcaaatgaatcacgaagacgacatcgttcttttgattcaaccgttgaagaatctgaaaattgtaattttcttacaattagtgaaaatattcatttgtttgatcttgcggctaataatccaattctcaaaaattcaaaaattatcctccgagaaaaagttttcgaagcacattttgaataaacatcttacttttactggatagtcgaatattttgtcctttgtcatcttctttcggtggagttttatcttcttcttcatcactatccaaattacattcaactagtcgacttttttcttcttcttttgttattgttattctgaaaataataattgaatttcaaattatctctctagtttttaaactaatcaaactttttttggaacaaatatcaaaaaaacacgaagtacacttttgatatacttctcatcaaactaaattttgtgaaaaatagtatctgtttgaaacttaaaaattgttgtttgtattccaaatgcaaaattttgccatttttaaacaaaaatacggtttgaacacaaccgattctggaggattgcgagtcgttaaaagtactttaggtattttttacacagttttcaacttttcttgatttttataactcaccgattgggttttaactcatccgtctcctcgtcaacatccacgtcatccagcgtgaatacgtccgactcgttggcaagaacacgtggcattcctgatgacctgatttgatatttagcgtatccacgagtcgacgacgtgcttggcacgttcatttgacgagaagaggtctgaaag