Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_C32E12.1   

sjj_C32E12.1RNAiJA:C32E12.1
PCR_productsjj_C32E12.1
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSC32E12.1 Source_evidenceePCR944WS150 Sequence/Annotation Release
Overlaps_Gene C32E12.1 Source_evidenceePCR944WS150 Sequence/Annotation Release
Chunk_score Abs_score839
Max_abs_score839C32E12.1
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI52335915234786
Overlaps_transcriptC32E12.1 Source_evidenceePCR944WS150 Sequence/Annotation Release
WB_DNA_textsjj_C32E12.11196tttcagggcaagaaaccatcgacagatccacttttttccggacccttaacacaagctccaaagagatcaaagggagaaacgcaggaactcaatcaattgctcgaaaataacgctcaaaataagccgaagaaagtgaaggaaccatctggaatcgatgcaattgatttgaaatctgatagtctagttgttgagaagactcaattgtctggtgatagtgcacttcgagtgactgcaaaggaaaagaagaagaccaagaagactgagattgtagtgaaagaagttaaagaggagaaaaagaaggacactggttcggtatctgaagatgaaaatgatataaaggcatttcaagcggagaaatcgaaagaaatcgaaacgaagaaaaatgaagaaatggagaagaaacaggaggagcccaaagtcaaaccgtaagttttcttgctttcaaggctaaatacctacttaaactttcaccaacttaattgagttctattttaagagttccccctggcacaacacctgacaccacaacaacaactccagagaagaaagtgagcaatctgtacaagattctttcagaagtttcagatgtacagactattctaatcagaatttctaaaatatttttgaattttcagtcaaagagcatcacagactcgaacatcaaaccagagttggatgaaattcctgaagcaagaactcccgaagcagaaggtcctccgatgatggtgaaggaaagatctgagaagcgtttgaaaatagaatcaacacaagacactgatgattccgatccaaagaaggtgaagtcgggtccgaagaagatcagaccagagagtttcaaattgaaaaagacgcagtcgttctcaccggtaagtggttttcaacacaaaatagttttttgaatattatttttaggttaacatagtctctacagttcctgatcaagtcaagaagccaggcaaaaattctccgaaggatgaacatgttatgaaaactccaccaattgagaacccaggtttgatttcaaattaaacatgcatctaaagttgaatttaagttgccgccaagaagaacccatttgatccactacgttcagaactggagaccccgattcaagaacctgcatttgtagtcaatcgtggtgatacaaagatcaagaatatggagatcaagttggtcaacttggatttggttggcag