Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_C32E8.2   

sjj_C32E8.2 RNAi JA:C32E8.2
Simmer:C32E8.2:Screen_B
PCR_productsjj_C32E8.2
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_Gene C32E8.2 Source_evidenceePCR638WS150 Sequence/Annotation Release
Chunk_score Abs_score554
Max_abs_score554C32E8.2
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI37878973788866
Overlaps_transcript (5)
WB_DNA_textsjj_C32E8.2970attttctcccggaaattgttttaaaaatatctatttaagctttttttcgcaattttgcgttgttattgagttattttctgtatttctatcgcaattttcattagtttgaactaaaatcgcaattttacttctttttttcagggtacaatggctccacgtggaaaccaaatgttgggcaatgcccatttccgcaagcactggcacaagcgcataaagacctggttcgaccagccagctcgcaaactccgcagaagacagaaccgtcaagctaaggctgtcgaaatcgctcctcgcccagttgctggacttctcaggttagatagaattagtcttttcattaaatatagtttcatttcagatctgtcgtccgttgcccacagaagagatacaacaccaagactcgtcttggacgtggtttctctcttcaagagctcaaggccgccggaatctcccaggctcaggcccgcaccatcggaatcgccgttgatgtgagaagaaccaacaagaccgccgagggacttaaggtatgtaataaattattttgcatgaaaattaaatgtatacaatattttaggccaacgccgatcgtctcaaggagtacaaagccaagcttatcctcttcccgaagaaggctagcgcaccaaagaagggagacagctctgtaagtttttttttgcatttaattaagtttgaaagtatttttgaacttagtcgataacagtttgttaaataattcctgcataatatgaatattgatttttaaggctgaggagctcaaggttgccgcccaacttcgcggagatgtccttccactttcccacaccatcaccttcgacgagccacgccaagttaccgacgccgaacgcaaggtcgagatcttcagacttctccgcaaggagcgtgctgacaagaaataccgtggaaagcgtgagaagagagccagagaggccgctgaggagaataagtaaat