Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_C32E8.3   

sjj_C32E8.3RNAiJA:C32E8.3
PCR_productsjj_C32E8.3
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSC32E8.3 Source_evidenceePCR543WS150 Sequence/Annotation Release
Overlaps_Gene C32E8.2 Source_evidenceePCR6WS150 Sequence/Annotation Release
C32E8.3 Source_evidenceePCR637WS150 Sequence/Annotation Release
Chunk_score Abs_score553
Max_abs_score553C32E8.3
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI37861953787758
Overlaps_transcript C32E8.2a.2 Source_evidenceePCR6WS150 Sequence/Annotation Release
C32E8.3 Source_evidenceePCR637WS150 Sequence/Annotation Release
WB_DNA_textsjj_C32E8.31564gttatgcttttcaactgacggacggcgcaattagggaacaacgttggcgttgcgcgaagaatgaatagataataatcttggctctcgccccattgtgctctttctactccacactcagcttctgccaattccttccgacacatgggcttttatacttcttcttcctcaaattgctaaacaaagtcagaaatcgagtgcagatattgccgccacgtgattctcttaattctcttatgctcgatagagctccacctatttttgatttatgctctcctctcacgcagttttctcaactctctttgaatatttccatgtttccatggttgccatcgagtgctcattcttttccggtcgttattcctattttcactatacaaacaccttttatttttcagaaaatcatggccgctgctgctggattcaactgggatgatgctgatgtgaagaaaaggtaaattatttggattttaaattataaactttgcaagaagtccagtagtttaccgatttcaattttggtaaccagaaaaaaattaacaaaacattgtttttcacacagtttcgagttagaatttcgcatcaaaaccttttaattttctagatgggacgcgttcaccaaattcggagctgctaccgccaccgaaatgactggaaagaacttcgacaagtggcttaaggatgctggtgtcctcgacaacaaagccatcaccgggacaatgaccggaatcgctttcagcaaagttactgggtgggttgaactttactgtctgcatcgaattaactaaaaaatttattatagacctaaaaagaaggccactttcgacgaaacgaagaaagtgctggcatttgtcgccgaggatcgcgcgagacaaagtaagaagccgattcaggacgaactggacgcaatcacagagaaattggccaaattggaagcgccgagtgttggaggtgcggcgaaggccaatgcggccggcgtttacagccgtctcaccgatcacacaaagtatactggagcccataaagaaagattcgatgccgaaggaaaaggtatttgtagaaaatgaattcacgaaagaaatatgtaatttcaggaaaaggaaaatcaggacgtgcggatacaacagaaaatactggatatgttggagcttacaagaataaagattcctacgataaaacacatggaaagtaatcaaagatctctctatggaccaaataaatgcacttctttttcttttcgttttgtctatattctcgaatgtataattcccagtaatatctttgtattaataaatttatttatttaactttttttaatctaaaattcaaaagcaaataatttcagtaattttttgaattaaattaattccactttctagtttttagagatgataaagtagtttgaagttatgtaccatattaaaaattattttcagaaaagttaagttcactgaaaataccactttcttattgatttaactattttaaatggaaatattcaattttatagactgcgaaacaaattaggcacacattttgttcctgcgtaaatcgacacaagtacaca