Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_C32E8.5   

sjj_C32E8.5 RNAi JA:C32E8.5
Simmer:C32E8.5:Screen_A
Simmer:C32E8.5:Screen_B
PCR_productsjj_C32E8.5
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSC32E8.5 Source_evidenceePCR810WS150 Sequence/Annotation Release
Overlaps_Gene C32E8.5 (3)
Overlaps_transcriptC32E8.5 Source_evidenceePCR890WS150 Sequence/Annotation Release
WB_DNA_textsjj_C32E8.51062acccgacgtgataccagaagagatgacagtccaaaaattaaaagagaagtgaaggaagaacagtttagtgataagtgagtttaacataaaattattttactcaaaaatgtaatcctttagtgactcgccaagacgtcgacgtgatgatagaggtggccgacgggatgatcgtagagacaatcggagagatgatagacgagatcatcgagatgatcgtggcgacagagatcggcgtgataacttcagaaggccggatccagttcgagaagacggaaagcagtatggattggaaaagaaagaagagaattggggaaagccagaggagccggcgaaggagaaagagaaagtgaatctggggacatcaggagccttgacagaggacacgaacacatttcgaggtgtcgttatcaagtataatgagcctccggaagcgaaaaaaccgaatgccaggtggagactgtacccattcaaaggagaagagtcacttcaggttctttatattcatcgacagtctgcatatctcatcggaagagatcacaagattgcagatattccagtggatcacccgagctgtagcaaacagcatgcagttctacaattcaggtgagttcagagattagttttgaataaaaatgtagatttctccctttcagatcgatgccattcacccgagacgatggaactaaagctcgtcgaattatgccgtacattattgatttgggaagtggaaatgggacgtttctgaacgagaaaaagatcgagcctcaaaggtacattgaactacaagagaaggacatgctcaagtttggattctcgactcgtgaatatgttgtgatgaaggagcgagagattacggaagaagagctcgcagaaggagaagatgttaaaaaggaagaatctgattgattgttttttgcctgtttgaattgtttttctttctgtaaagtattttgttctcacttttttcgttgttgaaattgtaagattttgatcacaatttgaaaaatgattctagatttcagattagtgactttcagtctcccgctacaaacaattccacga