Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_C32E8.5   

sjj_C32E8.5 RNAi (3)
PCR_productsjj_C32E8.5
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSC32E8.5 Source_evidenceePCR810WS150 Sequence/Annotation Release
Overlaps_Gene C32E8.5 Source_evidenceePCR890WS150 Sequence/Annotation Release
Chunk_score Abs_score827
Max_abs_score827C32E8.5
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI37822773783338
Overlaps_transcriptC32E8.5 Source_evidenceePCR890WS150 Sequence/Annotation Release
WB_DNA_textsjj_C32E8.51062acccgacgtgataccagaagagatgacagtccaaaaattaaaagagaagtgaaggaagaacagtttagtgataagtgagtttaacataaaattattttactcaaaaatgtaatcctttagtgactcgccaagacgtcgacgtgatgatagaggtggccgacgggatgatcgtagagacaatcggagagatgatagacgagatcatcgagatgatcgtggcgacagagatcggcgtgataacttcagaaggccggatccagttcgagaagacggaaagcagtatggattggaaaagaaagaagagaattggggaaagccagaggagccggcgaaggagaaagagaaagtgaatctggggacatcaggagccttgacagaggacacgaacacatttcgaggtgtcgttatcaagtataatgagcctccggaagcgaaaaaaccgaatgccaggtggagactgtacccattcaaaggagaagagtcacttcaggttctttatattcatcgacagtctgcatatctcatcggaagagatcacaagattgcagatattccagtggatcacccgagctgtagcaaacagcatgcagttctacaattcaggtgagttcagagattagttttgaataaaaatgtagatttctccctttcagatcgatgccattcacccgagacgatggaactaaagctcgtcgaattatgccgtacattattgatttgggaagtggaaatgggacgtttctgaacgagaaaaagatcgagcctcaaaggtacattgaactacaagagaaggacatgctcaagtttggattctcgactcgtgaatatgttgtgatgaaggagcgagagattacggaagaagagctcgcagaaggagaagatgttaaaaaggaagaatctgattgattgttttttgcctgtttgaattgtttttctttctgtaaagtattttgttctcacttttttcgttgttgaaattgtaagattttgatcacaatttgaaaaatgattctagatttcagattagtgactttcagtctcccgctacaaacaattccacga