Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_C32E8.7   

sjj_C32E8.7RNAiJA:C32E8.7
PCR_productsjj_C32E8.7
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSC32E8.7 Source_evidenceePCR1089WS150 Sequence/Annotation Release
Overlaps_Gene C32E8.7 Source_evidenceePCR1089WS150 Sequence/Annotation Release
Chunk_score Abs_score986
Max_abs_score986C32E8.7
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI37786643780813
Overlaps_transcriptC32E8.7 Source_evidenceePCR1089WS150 Sequence/Annotation Release
WB_DNA_textsjj_C32E8.72150cacaagccatgggtttacattataaactttgagtccttaccatagtagttgcagaagcctccttgccagagctatttgccttattcccatcgaaaagggataaaatgtcatcggacactgcatttggtttaggcggtggaagaattggtgggacgaaagaggaagtatcaaataaagtggcaagtggaccaattggaaatgcaattgaagcagctgattctaaatctaacagatctccagttttccttctttcatcatcaacatcttctattaaaggactatcacattgagaacgggattcatcttgaacttcttcttcaccaaattgtgggctttctcttccaaataaaaggtttttgagttcttcttcgtttcctcttggttgactcgtttttgcactttcctctttttctgatttacgctctctttcgggttttgttccggtggccaggtgcttaaatatttatgaattttgaagtgagagagatttatttgaacggattcagctacatttcattaaattattcttttgaataaaaacttacactcagaatctcaaaatcgtaattgttatagcaattgatgttttcagccaatgtctcgaaagctctggaagtttttgaataatattcgtagagctcattttggtaatgggtcagaacataggagagtagattggatcgcgaagcagatagtaggtccacctggaaaaatatattttttatgctgtctatagttccttttttcattctgaagatatgtataagtaaatattttccaaataatagaaacataaaattatgtgctcagttgacaatttttaatcaaaaccaaagacagccgaaataagagcagtctttagagaatttaggctgtaaggttttgcacattgagcatcccatttcctcatttatgttctcacgtaaaatgtgatgtgacaaggtagattgcatgggcttatatatacatatgccaaatatctttaaaaaattatatttttagtaaatcttttggtggagattagctttcgtgacattttcaattatgttttagtacgagctgaagtttggtctttagagaagaattaaaaatagatagaaattcggtaaatcagtagctcacaaactttttggaagacttcaaattagaccagagagatgtgtggcccatttgtttggtaaattcataaactccatttttctcaccattgtggcaaagttttgttttggaaacttatatcgaaatgtagagaaatatttattctttctaaaaattgttttatttttaattgaatgttttgaaaagttgctcaaagattttctctaatagtaagccgcaatgtgtcagcacttttttgtaaatgtcccaaattttcaaagtaaaatctaaaagtcattcaagatttgttatcttgatggtcaagaaaaatataaattcaaagtcaattttcttcacacgtaccttctgcaaagtgtccgtcttcaacctatccagccgttctttattcgatttcaccgtcgtctgtgcctctctgaacttttccatcgacccgtcaacttctggatccagctcttcactagttttcttcatccataaaagacttccacgatactctgttctacacatttgcacggcttcaatcgtttgtgagcagtcaccaattgcacgttccacgaatacgcttagtttgttgtaaaatctgaaattagaaaactttgaaattaatataaaattaacaatttttgtggcgggacccatcgacttacgtggacacgccaatccgtgctgcattcaatcgatgactagagaataaaagtgatcttccgacggctattagaattcgcccgacggcttcagttttgtctatctttcctttttcttttagatattttccaagcacgttctgaaccaaagtttcatctgaaatttgattactctaaatatataaaatagtttcaatcccaccaagaagaaaatttgcataattatccacattattcagaagctggaatgaagttccgtgaactgatcgataaagattcaggcacgtatcaagttcattgtcgctggcctcaaggtgctcgtcttcctgaaatataagaaacttgcgcgtcaaatttgatgtaattcaccctacagtactctctcgc