Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_C32E8.9   

sjj_C32E8.9RNAiJA:C32E8.9
PCR_productsjj_C32E8.9
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSC32E8.9 Source_evidenceePCR621WS150 Sequence/Annotation Release
Overlaps_Gene C32E8.9 Source_evidenceePCR628WS150 Sequence/Annotation Release
Chunk_score Abs_score546
Max_abs_score546C32E8.9
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI37944773795653
Overlaps_transcriptC32E8.9 Source_evidenceePCR628WS150 Sequence/Annotation Release
WB_DNA_textsjj_C32E8.91177acaaatgccaaagttcacagatttgttaattttcatctagactttttttcaagtttaatagtattggagaaataaatatttggattcagaattgttcatttctctaaaaatagtttaaaatacaatacaaaattctttcaaaaaaaagcaaaattatttcttgacgaccgcttcgagttgtttctgaagtgcatttcgatgagtttccccgttccagacggcttccagcacttgtttttgctccgtttttcctatttttacagcgttcagcatagctttctgggctcttgtcactttcaaaccagcgctagccacttggttgatgaagttctgaaaacatatttcaatgtattatagcaatggcgctccacggcgaggtaaaaatgctccgcccccaaacgttgggtctcgttaggtattgacttttttcttgcatactttttccgttttaaacatgtttttcataataatggaagaaacggaaattaattttaagaaaagacgagaataattgaaaatgttcgaatacctaacgagacccaacgtttagaggcggagccttttcatttgccagtggagcgcgaatgcacctcgattttatgggatttctaggcgacaaatgacgtcacagttccgtacctcagcttcatcttcacttttgtacacataatccacatatccttgatcctttgcttcctcagctgacataacatttgcccgtcccattgcagctaatgctcgtcctctacccataattccctccatatattcggcacctccccacgacggaacaattcccattttcgattgaaaaaatgcgattttcgagccagaatgagcaattcgaatgtcggtcgacgagcaaatttcggtggctccgccgagtgcgtggccatggattttcgcaattgaaatagctggtgatgagtggagaagtgaaagaattgatgacatgtactcgaacatttggacgccaagcttttggtccgaaatctgaaatttaaacatttgaaagttggaatttaaaaattggaatttcattacatctttgataagacccaaatcagcacccgagcagaacgattttccaactcccgaaacaacgataattgcgttttgatcatcggaaaatagctgaaaagtgatatttcaggcatttttactacggtctcgcaac