Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_C32F10.1   

sjj_C32F10.1RNAiJA:C32F10.1
PCR_productsjj_C32F10.1
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSC32F10.1b Source_evidenceePCR703WS150 Sequence/Annotation Release
Overlaps_Gene C32F10.1 Source_evidenceePCR817WS150 Sequence/Annotation Release
Chunk_score Abs_score754
Max_abs_score754C32F10.1
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI58335025834428
Overlaps_transcript C32F10.1a.2 Source_evidenceePCR703WS150 Sequence/Annotation Release
C32F10.1a.1 Source_evidenceePCR817WS150 Sequence/Annotation Release
C32F10.1b Source_evidenceePCR703WS150 Sequence/Annotation Release
WB_DNA_textsjj_C32F10.1927accaatttcggcattctacgctgaaatgccatccgaagggatttcatttaatgctcatatctacacaaaatcatccttccttggtctctcaattggtgttgcaagcattggagaaggtattctaacacttcataactatggtgatgagcaatacacaatcacattcccatctggatacggacgatccattatgagtactccatggttcgaatttggtggaaaagtgaaggttgaatgtgaaaagactggatatcgtgctgatattgagttcctcaccaaaccgttctttggtggtaaaccgcatcgaattcaaggatcaatttgtcgtgatggtgccaagaaaccggtattgacgcttcgtggagaatggaatggaacaatgtatgcaaaaacacaaaatggagaagaatatgtatttgttgatgtcaaagcaaaacctgaagttaagaaagaatgtgttcctgttatgcaacaagggaaacgggagagcagaaggttagaagaaaacattttcatcctgacagaaaatttgaaaagttctgacatttttttcagattgtggagacatgtgacagcagctttgctcagaaatcgtattcaaactgccactacatcgaaaagattcatcgagcagagacaacggaaagaagcgaaggtatttattatattctcagtttcgacaacataacattctaattctttcaggaacgcctcgaaagtggtgaaaagtggacgccgcttcttttcgacacaactgacaaggacggtgaatggatgtataagcagaagttcggtgtcagaaaagcagtttgagtgtccaccatatttgtgctaaatagatttgaatttgtgtgtaatacgagtataattgcctaaattagttcagttttgaactccatcttgtgtggtttttcctgcatccagctc