Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_C32F10.2   

sjj_C32F10.2 RNAi (5)
PCR_productsjj_C32F10.2
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSC32F10.2 Source_evidenceePCR886WS150 Sequence/Annotation Release
Overlaps_Gene C32F10.2 Source_evidenceePCR886WS150 Sequence/Annotation Release
Chunk_score Abs_score802
Max_abs_score802C32F10.2
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI58132235814364
Overlaps_transcriptC32F10.2 Source_evidenceePCR886WS150 Sequence/Annotation Release
WB_DNA_textsjj_C32F10.21142ctggaagacgtttccgtgatgcagaatttcttacaaaaatctcaaataatcattgtctggaaaagttggcattaggtggaaaagtagcatcagaaaagttggtaacacagtcaaaagaacagccgagagttccgtgtgttgagtataatctcgaattgggaaattatccagacgatttggaatcgaacaatcaaagtctttataatagattgacaaaaattattggaagctggaaattggagaattcgaaactcgaagagtaagtagcgaatctattttgcacaaaaaaaagacaaaaaagacttttttttcggaatatagtgaaatatgaaaaaaagacaagtgaaatatgaaaaaaaatgcttcgatgttctttgatgactacaaatcagaagtatttatttcagagtgtgtggcacaatgtccgacagtccaatggcaacaattcttctgaaaagtgatgaaatgacaaataaattcgagcgaactttatctgcagaactcggagagacgatcaatgagaatattcctaaatatcactataatgttcgaaaagaattggaattagtttttctcattttcatggagaaaataattgttgcagaattgaaaaagaaagtacgagaggaggacttgctggtaagtttattgttaaaaaagtattttttgccaattttgaaattacagaatgtgattcgtcgggaagaatttcttgattcagttttctgtttctgtgttgaactgatccttgtttccaatggatatgatcgtccatttccatggagtgctgaactgtgtggagtacatccatttatgtttcataaagtaattgatttgatgataacacatgagaaacagctaagtcgtcaaatggttcaacattttagtcgaattgaagaaactgtaattgagtatttttcgtggaagtctgatagtccattatggccaatggttgtcaggtgtccatttgcacattttcaagaattcggagaggattgggctgataaatgttagttttttaaaaatatttatttggagaagtatagattttcattcataaatattgcagtaaactcgtactcaccaataaaattcactccaatcaagaagcctgatgatctacgagacgaacttggaagacc