Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_C32F10.5   

sjj_C32F10.5 RNAi JA:C32F10.5
Simmer:C32F10.5:Screen_A
Simmer:C32F10.5:Screen_B
PF:GL1_3F5
PCR_productsjj_C32F10.5
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSC32F10.5 Source_evidenceePCR1077WS150 Sequence/Annotation Release
Overlaps_Gene (2)
Overlaps_transcriptC32F10.5 Source_evidenceePCR1077WS150 Sequence/Annotation Release
WB_DNA_textsjj_C32F10.51165ttatcatccgcactcatggacttccactttgctccggcttttttagcaacatctccgagtgtatccccatcttctttcattgaattacgattggcattgaaccagatgatatatgcagtggttgctcgtttcggctcatttggatctttagttttctttcctttcttcacagctttctcctttaccggcttctctttcttctcgcgtttattcttcttttctttactctccttcttttttggttcaatattctcttcatctggatcagattctccagttcctgaagcatctttctctgagccagaatcatattcatcgtcaggttcacttccagaaccttctgatgagtctttgtcattcttctgcttcttcatatccttatccaaatcataatcctcatcagtactttcatcatcgctgtcatcatcttgttcacgaccctctgctttcacagttgacttgtatggatcgatatcatcttcatcgctgcttccataaccagctgatttgttatcgatacgatgagaattgcgaattttgatctctttcttgtttagatagtcgaatagtttgttgttctcttctttatccattgcactgaaagtcaacgatgatccagttttcagatcaatctcaaaatcaaaagttcttgttacagttccgctatcagaacgtgcgaaatgacatgagctaatctcttcaaagcgaatgtacatgaccggcttttgaataaacaaaaatcccttttccattgggtacaacaatccaaggttctgacgatgtgtacattgtatggcaggagtgcccgaacttccgaggaatcgtccaggaacggtgactttcagattgcaaattgatttgaagagaattgagattgtctcatagattggtccagtcatttcacgttgaagatttccattgaaatagtcgagttgttcactgaaatactctcaaattattggacggcaatataaaatatatttgagtggcacggaattgttcccagaaaattctgaaataaactcactcagtcaacgacaactccaaatcttcttcttcatccttcccaaactcgaaaatgagataactgtagtgtgtctgtccctggcgaatgggtgggttcaacgacaacacaaaatatacttggcgtccatctttatgagga