Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_C33A12.14   

sjj_C33A12.14 RNAi JA:C33A12.14
[cgc5655]:C33A12.14
PCR_productsjj_C33A12.14
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSC33A12.14 Source_evidenceePCR642WS150 Sequence/Annotation Release
Overlaps_Gene C33A12.14 Source_evidenceePCR642WS150 Sequence/Annotation Release
Chunk_score Abs_score579
Max_abs_score579C33A12.14
Specificity_index1
Rel_score1
Map_statusUnique_ePCRIV94888129489971
Overlaps_transcriptC33A12.14 Source_evidenceePCR642WS150 Sequence/Annotation Release
WB_DNA_textsjj_C33A12.141160gatactgttgaaccggggaaaaatcaatatgtgtttctagtaattagtttgacacagatttcatgcttttcgtactttttattcaattatttaattgtaagattgccagctaccggatggtttacctcgtattgtgcttcaattgaaccaaacaaatggcttttgacaatttcatttttcacctcttatacaaactatacagcaatgatatatccgtttttcatgccaattgttaggttgatcataatcacacatccaaaaaatcacaataaggtatttaatagtttgaagaaattggaaatattttctatagattagttttaagtttttgttgtgggctgaaacatctaagccctaggagcgcggataattgccagcagataattcatcaaactgataatttttctaaaagtttaattaattaagtgattattatagatatttcaaataatatcatatttgatttttcttgttattccaataaaaacgaatttccagataaattcaatagtaatgagaattgctgttccagttgctctaatctatccaatttgcttcacattttttctgattcctgcaataggagtatgtaagcaattagagttcccatatcaattcggatcaatttgggtttactacgtcggtcctgcgtttggagtaagttccaattttcaatttaacaatcaatattttaaaactgagaattttttgaattttcaaaaagtaaaaaaaaatacataaaaaatgattcagctccgtaacactccgttcttcctggccaacgcgtcattttggctagcatgctctgttctagccaatttaattttattcctgaaactaacacgtgccagagaacagctgataactcaacaagttagcagcatatcatacagagcacaagtatcaataacgtatactacaattgcaatgattgtcttctatgtcacaaatggattaactctggtgagactggaaacaataaaaattttgcttatataattagtaaaattatttttaaatcacgatgggaaatctcaattttttattagatgcttccatttttttctaccaattatttaaaacgtatttttctttacaatccgaaaaacatatatagagaatgaaaattggaacacctttgaccgagaacagacccgtaa