Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_C33G3.6   

sjj_C33G3.6RNAiJA:C33G3.6
PCR_productsjj_C33G3.6
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_Gene C33G3.6 Source_evidenceePCR735WS150 Sequence/Annotation Release
Chunk_score Abs_score651
Max_abs_score651C33G3.6
Specificity_index1
Rel_score1
Map_statusUnique_ePCRX1408272514083781
Overlaps_transcript C33G3.6.1 Source_evidenceePCR735WS150 Sequence/Annotation Release
C33G3.6.2 Source_evidenceePCR735WS150 Sequence/Annotation Release
WB_DNA_textsjj_C33G3.61057acgctcagcttcttcctttattttttctcgatggtttagattatgtctctgaaattatgaaattagaaaaaaagactttatcttctcttttttctttttttcttttttttcaagagtcaatttatacagttttcatcacattaattcgtaaatttttgctaagtgagaagattattttataagctcatttctgggctagaaaatataatttgtcatatacatatatactcaccagcctatctgcatcaatagttttttgatcaagagatgccaaaaattcagcagacaaacgctcttcttcagacaatcgctttcgtttttcctcttcggtttctcctttttgaacattttcaactgaatcagtttcataattattcttcatttcatctggcttttcatctatgttaaatccttcattggtttctgcgcttgttggcttttcttgtccttgttctaacggtttaccacttccaccaaagtatttcaattgaatcaaataagattcatcttcatcctcttcttcgctacattttccgttgctttctgaatcgtgaaattcatcaattgatatttcatcttcacaattgctggatggcagttttcccgatgcatttttaagatcatgcattgactcttcctttttgaagcttcttattagattcaagtatgcggtttcttcgtcgtcactttcaggatcttcttcatggtttttggcgttctgaaaataaaaaagttaagcaagttgcgcatattgctgaaatattaaggaaaaaggcgttctggctagaattatgttatatatatatatatatatatatatatatatatatatatatatatatatatatatatatacctgatcactgttccgagttgatttttgattctctccaaaaaattgttcgatggaaatgttcttctctaccgacatttgcttttctattttttcctcaatttcactatttccaatgcggtttctttcgatatagttttttcgatttattccattacatgctgttgcattttcgccagtgtttttgaggttttccgtgttaga