Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_C33H5.15   

sjj_C33H5.15 RNAi JA:C33H5.15
PF:GL1_3F4
PCR_productsjj_C33H5.15
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSC33H5.15 Source_evidenceePCR696WS150 Sequence/Annotation Release
Overlaps_Gene C33H5.15 Source_evidenceePCR696WS150 Sequence/Annotation Release
Chunk_score Abs_score570
Max_abs_score570C33H5.15
Specificity_index1
Rel_score1
Map_statusUnique_ePCRIV77952937796361
Overlaps_transcriptC33H5.15 Source_evidenceePCR696WS150 Sequence/Annotation Release
WB_DNA_textsjj_C33H5.151069tgcaggagttgatgatggagcaatgagcataggtgcacgccgatttgttggaattgtagatgcttcttcgacaatagatgaatcagctgaaaattcatgaatagtaatattatattaaaactttaagtaatgaaaattaccgttaaaactttggaacagctcacttcttcgaccctttccgacgctttgtttttttcgaggagttccatttacagcgttttgaattgaagacgtactttgagatgaattattatcaaatcgaatttcattttcatcaatttctccttgcatagaagactgacaaaatggtatttcgtcaactgaaacattactcaaaaatgaaaatatattcaaaatcatttcattcctacctctttccaaatttaactctaattttggtggccgtcgcgtatttaagccactcggttcaggttccaaatctttgaaaagtccatctaattccaatcctgtctgttgaatattctgtactaattttttatgtaaaactgcagcatgtgccaggcgaaatttcaacctttgctcgacaattagctcaattcgctgctcaagagttccatcgatgagctcttgatttctgaaatatttgaataaaatatatagtttccacattaaaacaagatttacttacttttgtcgtaaggcgacattttcatttcgtagtttttcaatagtctttgtgcattgtacaacttgttgctgaaaaattatatacgtatttctgagcagcaggaaattgagaaaaaaaactcacttttagcagaagattcttcttaacaagagaatcgttggcgctcttgaaatttattgttggttcagggactgaaacatttgtattttacacataaactttgtaaatataataataccttctttagatggtcgtttttttgctgctacaattcctccaaaaatagattgtgcagtttttgcatccatttataataaatcttcaccaatcgatacagttttgccacagggtgatgaacaattcaaacgttcgccgctttcacaatgaccacggaccacacaccgagactgacgacaagct