Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_C33H5.17   

sjj_C33H5.17 RNAi (5)
PCR_productsjj_C33H5.17
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSC33H5.17 Source_evidenceePCR769WS150 Sequence/Annotation Release
Overlaps_Gene C33H5.17 Source_evidenceePCR769WS150 Sequence/Annotation Release
Chunk_score Abs_score706
Max_abs_score706C33H5.17
Specificity_index1
Rel_score1
Map_statusUnique_ePCRIV78114397812377
Overlaps_transcriptC33H5.17 Source_evidenceePCR769WS150 Sequence/Annotation Release
WB_DNA_textsjj_C33H5.17939gccaagcgtttttgatgaatatccagccatttcctgagtctctttacgtacatcagcaaacgttctttcgtttttcttctgaaaaaaaccattttagtaggcaagatttataatttttttgttaaaaactctatgagctaaatttttaaatcaaataatatgtctcttattacgaaaaaaaaaacgatacctccaattttctgttgatgaaagcaaaaatatccatttcggactcatcagtagtcttcagcttcttgatgtttttgtttttttgaacttcttttctatcaataaattttcgttttcgtgtcatcacttcatcaagagaagcatctgaatttgaaatgttttaaagaaaatgtctattctagaaatttaaaaatgagcctacttttcttacaaattcttgcttgaattgcgtgtacaattccatcacttcgtttcccaagtccttctccaactttataacccattttcatcattaacttcataccaacacctcctccattccatttccccaaatctccaacagtaacatttccaagtgtttcttgttttaattctttccatgattctgagctttgttcttgtttagtcggctcttcaacttcccctattggtaccaaatctttccgtttcgatgaaatctcaattccacttttcaaaaccttaacggcaacattctgtgtatcgattgcactaattctacccaactcccaaatatcagacattcctttcacaagtactaatccttcttccacaataaatgaatagtccggcacttggtaatcttgaattctttcaagctccacagaatatccatgactaaatcggcagttttcattgaatttacatgaagatgagagaaaatgtgtgcatggtttcattgcagaacatgttggatgagaaaacagtacacgaacacgctttgacgattca