Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_C34B2.10   

sjj_C34B2.10 RNAi JA:C34B2.10
Simmer:C34B2.10:Screen_A
Simmer:C34B2.10:Screen_B
PCR_productsjj_C34B2.10
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_Gene C34B2.10 Source_evidenceePCR517WS150 Sequence/Annotation Release
Chunk_score Abs_score475
Max_abs_score475C34B2.10
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI1068237210683104
Overlaps_transcript C34B2.10.2 Source_evidenceePCR473WS150 Sequence/Annotation Release
C34B2.10.1 Source_evidenceePCR517WS150 Sequence/Annotation Release
WB_DNA_textsjj_C34B2.10733gggagtaggataggaggattcaagacttcagaataaaaaagtaaaatgtgtcgcattaaaacgtcaataaaatattaaaatcgttgtagattgaaaatgaatttattatggttcagaagatgattcttatatcacacagaaaaatgaagaagagctcataaataatttaatttaaaataaatatttgaccagatcccgagtaaaacgtttttctttagtttttgcatcattgccgatttatttcgtcttctttgtctcctttttcttgtctccagattcttgtggttccgcaggtgtgtgccactgaaaattaaaacattttatacgatttctgtaactttttctcaccacaatcgggttctttctgaagaggaatggccatggtggaagaatgatgagagctgtgaacgcagatgctcccagcactgtgaacatggcatatgaaagctgttgagtccagaatccaacgaggaagccaataattccagcaatagtgaggattacctaaattttattgctttattttatgtaatttcagtcaatcaattgtggtttgttacctggtaagttctctcggcgactttctgtccttgaaaatcaatatgcgacgatagtttctgcagtggagcagggagcattgcaatcattccgtccatggttaattatgtaataattaaaaatcaaattcagttataaaaatacaaaaagattaaagcaaaacgaattcggaata