Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_C34B2.6   

sjj_C34B2.6RNAiJA:C34B2.6
PCR_productsjj_C34B2.6
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSC34B2.6 Source_evidenceePCR705WS150 Sequence/Annotation Release
Overlaps_Gene C34B2.6 Source_evidenceePCR705WS150 Sequence/Annotation Release
Chunk_score Abs_score621
Max_abs_score621C34B2.6
Specificity_index0.816
Rel_score1
Map_statusUnique_ePCRI1067729410678485
C26E6.11 Chunk_score Abs_score140
Specificity_index0.184
Rel_score0.225
Overlaps_transcriptC34B2.6 Source_evidenceePCR705WS150 Sequence/Annotation Release
WB_DNA_textsjj_C34B2.61192aaatttcaccagtcatcgccatgtcctgcacaacaggtcggtctaaagcgagtgaaagaagacttgagacaagagttactcctgcagatggtccgtcttttggtgttgctccctagaaaaatggaattggttagttgaaattatttcaagattaagctcacttcgggtacatgaatatgaatatgtgctttatcgaagaatttgttatcgggttgctctcttgcaagaattccttttgcaacagtcaacgctgttcgaacactttctttcattacatctcctaaatttccagttgtttcaatacttccatccttatcatttgtcaaatcaacaggtcgtttcaatacagtttcaatataaagtgcagatccacccattgctgtccatgcgagacccattatcacctgaacggaacgtgaattaagtttttaaaacagttttttcgcttactccaggcggtgttacttcatacattcgatctgatgtgaatttgggtcttccaacgaacttttgcaagttttctgtgcaaactacaatttgttcggctgaagattttaaacaatctgcagatgatgtagaggtgattggttcggcttctgagttttcagtgatagcagttgttgctttttcggctggctcctcatcctcgttttgttgttcagcaatttgaagagctgctttacggaaaatctggaaaaaaaaggtaatttctataagcaatctaaatataattgtcgaaacagaacaatcaactcgaggcgcggatctgagacccgaagaactcgggggatgtccaattgggggattaccaactcgggggattggccccgcccacagaaccgtggcttgcaatacgcccatttctgcaactgccgcacggtttaaaaattattttttcttgttaattctcgctctattgagaaaaatacagttttaaaaccgtgcggcagttgcagaaatgggcgtattgcaagccacggttatgtgggcggggccaatcccccgagttggtaatccccccaattggacatcccccgagttcttcgggtctcgcggatcgtcctgtttttaccaaaacatactctttcaatatgttgctgtaaatttctgactccagattcacgacagtaatgcttaatgagctcttccaacgcagaatcttcaattttcagttgttctgtggcgagagatg