Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_C34E10.1   

sjj_C34E10.1 RNAi JA:C34E10.1
Simmer:C34E10.1
PCR_productsjj_C34E10.1
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_Gene C34E10.1 (3)
Overlaps_transcript C34E10.1.3 Source_evidenceePCR713WS150 Sequence/Annotation Release
C34E10.1.1 Source_evidenceePCR713WS150 Sequence/Annotation Release
C34E10.1.2 Source_evidenceePCR713WS150 Sequence/Annotation Release
WB_DNA_textsjj_C34E10.11122aatgatgaagtggctcattttgtagaatttcctaaaaaataatatcttcagggcgatcactgcttcaacatttccgcaatcaaaccattcctgggatggcaaaaatattcgaatgtatcagcgactctataccgttcacttgcacatatgccatggaatcaatcagatgttgatgagaatgcagctgttcttgcatataatggacaactatggaatcaaaagcttttgcatcaagtcaaattgaatgcggtaaagtattataagtgttttgtccaaactatgatacagttcttcagatatggagaacacttcgtgccactcgagatgccgcattttcagttcgtgaacaagccggacacactttgaaattctcgttggagaatgctgtagctgttgatacaagagatagacctattcttgcaagtcgtggaattcttggtaagagtaacaacgactatttttaaaaaatatctttttcgaaaaaattacgaacgaaaaaaaactgtattatgtacccaaacgcgaaattttgcagttcttgcgcgttcttgttgataaaaaatatgtaaaaaattggaaaaactacgaaaagtcgataaaaattccgtaccaaccggaaaatgtttcattaatttctcttccttttttcagctcgttttgctcaagagtacgcaggagtatttggtgatgcgtcatttgtgaagaatacattagatttacaggtaacaaccttatttcaacaattatttcaaattctattaaaaataattccaggcagctgcccctcttccactcggtttcattcttgccgcctcattccaagcgaaacatttgaaaggactcggagatcgagaagttcatattttggatagatgttatttgggtggacaacaggatgttcgaggatttggtctgaatactattggagtgagttttaacgaaattctcttgaaagtcaaataatcattttcaggttaaagcagataacagttgtcttggaggaggtgcttcacttgctggtgtcgttcatttgtatcggccattgattccaccaaatatgctatttgcacacgcattccttgcatctggaagtgttgcatcagttcattccaaaaatttggt