Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

Oligo: sjj_C34E10.1_b   

sjj_C34E10.1_bSequenceACCAAATTTTTGGAATGAACTGA
PCR_productsjj_C34E10.1