Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_C34G6.4   

sjj_C34G6.4 RNAi (5)
PCR_productsjj_C34G6.4
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSC34G6.4 Source_evidenceePCR947WS150 Sequence/Annotation Release
Overlaps_Gene C34G6.4 Source_evidenceePCR947WS150 Sequence/Annotation Release
Chunk_score Abs_score905
Max_abs_score905C34G6.4
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI58932245894422
Overlaps_transcriptC34G6.4 Source_evidenceePCR947WS150 Sequence/Annotation Release
WB_DNA_textsjj_C34G6.41199cagcatttgggggtgtaagtgatagatgaatatattcggttttcaatgtttcatttcaacttctctcctttctctgattcttccttacattttcttcaaacacggcttcttctaagtacttatcagcatgcttttatattgtttttttggttcaatgatcaattttttttaaatttttcctaatttaacaaaataactttcaggaatgcaaggctccacccacctcaatgttcaaaatattcaaattcaacggagacaaagtcggatggtttattggtggaatttttggagcatttatttttggatcagttactccagtttttgctcttgtatatgctgaaattttcaatgtaattttttagaaatattaaagtagaagtaaaactgtacatttttcaggtatactctttgccagctgatcaaatgcaagcaaatgtgtatttctggtgtggaatgtttgttcttatgggaatcactttcttcgttggattcttcacttctgcaaattgcctcggacgatgtggagagtcactgacaatgaagttgagatttgaagcattcaagaatttattaagacaagatatcgctttttatgatgatttgagacatggaactggaaaattgtgcacaagatttgcaactgatgctccgaatgttcgatatgtattcacaagacttccagttgttttagcatcaattgtgactatttgtggagctctgggaattggattctattacggatggcaacttgccttgattcttgtcgtaatggttccactacttgtaatgggaggatatttcgaaatgcaaatgagatttggaaaacaaataagagatactcaattgttggaagaagctggaaaagtagcttcacaggctgttgaacacattcgaacagttcatagtttaaatcgtcaggaacaatttcatttcacatactgtgaatatcttcgggaaccattcaatactaatctgaaacatgcacatacatatggagctgtatttgcattctctcaatctcttattttcttcatgtatgctgctgcattctatcttggaagtatttttgtaaatcaacaagctatgcaaccaattgatgtctatcgagtattctttgctatttcattctgtggacaaatgattggaaatactacatcttttattcctgatgtcgtaaaagctcgtcttgctgcttctct