Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_C34G6.6   

sjj_C34G6.6 RNAi JA:C34G6.6
Simmer:C34G6.6:Screen_A
Simmer:C34G6.6:Screen_B
PCR_productsjj_C34G6.6
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSC34G6.6b Source_evidenceePCR802WS150 Sequence/Annotation Release
Overlaps_Gene C34G6.6 Source_evidenceePCR802WS150 Sequence/Annotation Release
Chunk_score Abs_score718
Max_abs_score718C34G6.6
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI58777655878855
Overlaps_transcript C34G6.6a.1 Source_evidenceePCR802WS150 Sequence/Annotation Release
C34G6.6b Source_evidenceePCR802WS150 Sequence/Annotation Release
C34G6.6a.2 Source_evidenceePCR802WS150 Sequence/Annotation Release
WB_DNA_textsjj_C34G6.61091ttggaacgttcatcagcaagaatacaagtacgggtcttgttgttgtacatgaacgatttgcagttgaagtcattggatgagattgagagacgttgagtgcaaagagcttggcaagaatcgaggtcgacgttgatgatacggtcaagttcattcttcaattgctttccttcgacggcaatatattgtgtgatgtatggtgggtagcattgggctgaaaacattttatgatgaatgtacttaaatttttcgaatatgtacatttcgaaaaagttgttttttgatagttataatttttaaaaacaaggggaactgagagtatacaattttgaaatatattttcaatatttatcgaaataaaacttacatccagcacagttgttatccatgtagataactgtatcatctgattcctcaacaaagagtgatggtctgtccaaacgatcttcggtgttcaagatacattcttgatcaactgggtagaacatagcagattcacattcgaatccaaaagtgtcgaaagcattaaggcaggcagccatacaaatttgaatgtttgcagcagggacaacctcgcgggcgaatccaacgagaattctttgctcgaaaagatcgaactggaatggagattggcaaacgcgatcactcttgacacatgtcttggtgagaagttggcttccagcagttgccttttcagagcctgcacggaaaactgcacagcttccatccttgaactcaactccttgacaatcaagagaagccgagcagtgatcggagcattcagcaagatttgaggttgggattgttcggatgcgagcacccactgttgtgttgtgttggagaacaaatattgtttgagtttcaggaggacataacgtcactgatgctgaaaatattgacattaaagtaaatatacaatttcatcattttaagcctacttgcgcttctgaaaatgccaaaataattgataagattaaatagtttaaatagaaccaaaataatggagatcaattattttctagatttcaacatattctaatgttttggctacaaaattagcatcattaacttacgtaaagtgtccgcaagcacag