Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_C35C5.1   

sjj_C35C5.1 RNAi JA:C35C5.1
Simmer:C35C5.1
PCR_productsjj_C35C5.1
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_Gene C35C5.1 Source_evidenceePCR1068WS150 Sequence/Annotation Release
Chunk_score Abs_score1005
Max_abs_score1005C35C5.1
Specificity_index1
Rel_score1
Map_statusUnique_ePCRX1153036911531541
Overlaps_transcript C35C5.1.2 Source_evidenceePCR1068WS150 Sequence/Annotation Release
C35C5.1.1 Source_evidenceePCR1068WS150 Sequence/Annotation Release
WB_DNA_textsjj_C35C5.11173ttgaattttctgccgagcttcgaattgtgaagcgaaaaactatgcacagtcagcttgttaagacttttgccgaggagcacacccatttaagggacgcaagcagacatcgagcgatttctacagtgacactcgatagttccggttccggaaggtcaactcgttgcgagatttttgaagacagtcctagtgaagatgaaaacgatgaaaatcaattggacacaacacgaatcggaagaaaaatcgatccaataattgtggattctgataaagcttatttgattgccgagggtgaacgcatggcacttcgcatcaagagacttttagaccccgagcttcaaaagttccggagcaaaaatttcgtatcgagatcaaaaagcgtagatgctccaaaaacttcaaaacaaaaaacagtcatcagacgttctcaatcagtatgcgatctcaatgatgttaatgagtatgctcagaagaaagtgagaaacacgaaagattcatttgcaactttatttagagaccatgtaagtaaacttcaattttagtcagaaatcataattctattatctgaattttaaggagtattcaacgcgccgaacgtacgaagaacagttgaacaatgagcttcttgatgttgttacgacatttggaggtgccagcaatgtatctgcagacaagaaatacaacatcctagcgtctattctcgcttttgaaaaagaagttcaacttgtgaatgataagaatggagaattattcaagaccgtttcgaatttagttcaaagaaatagtttgcaacatgtgaaaggtgttatactcgcagaggacaaccaaacgttgcgaagcacggacaacacttctgaagtattcccagaatctaaagcagtaaatgagtatttaaagtttgaaatctacaaaagaaaaatgatggtaaatgctaaactgatggccgatacagttaaagtgagtttgtacccagttttaactattcaacttatatacttttatttcaggatctgaaactaaaacatgctgaatatagaccgtttgcaaaactcattgcaacatacgattcaattttcaagttcaatgtttacttattcgaacacttccttaactgcatcagcaagcacgtgttcaatccatatgcaatttattgtgaggaaacaagaccgacaggaa