Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_C35D10.1   

sjj_C35D10.1RNAiSimmer:C35D10.1
PCR_productsjj_C35D10.1
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDS C35D10.1 Source_evidenceePCR607WS150 Sequence/Annotation Release
C35D10.16 Source_evidenceePCR297WS150 Sequence/Annotation Release
Overlaps_Gene C35D10.1 Source_evidenceePCR609WS150 Sequence/Annotation Release
Chunk_score Abs_score546
Max_abs_score546C35D10.1
Specificity_index0.719
Rel_score1
Map_statusBest_ePCRIII48789774881168
C35D10.16 Source_evidenceePCR297WS150 Sequence/Annotation Release
Chunk_score Abs_score213
Specificity_index0.281
Rel_score0.39
Map_statusBottom50_percentile_ePCRIII48789774881168
Overlaps_transcript C35D10.16 Source_evidenceePCR297WS150 Sequence/Annotation Release
C35D10.1 Source_evidenceePCR609WS150 Sequence/Annotation Release
WB_DNA_textsjj_C35D10.12192atatcaatcgccatcaaacaatccgacgaaatcgagaagattctgtgccacaagttcactcgattcatgtgccaaagagccgataacttctttgtgctccgtcgcaagccactgccaggtcagaattaatactaatattcagagattaaagcgataattttaggttatgacatctcgttcctcatcacagcatctcacacagaagcaatgttcaagcacaaacttgtcgactttttgcttcattttatgcaggaaattgataaggtgaacattttaagttaatttttaaaaaattccataaatttccaggaaatttccgagatgaagctgtctctcaacgcccgtgcccgtgtttctgctgaagaatttttgaagcgtttcaattaattttctccccatgattcccaattcatttttctcattttcactcaaattccgaagactttaaactattatgtgaacacggttttttgatcaatttgtgtaaatatcatctttattctcaattttttcactttttgtttctgaaaatgactcccctcccaaaaatttcctgttttaggtcctattttgcctttttgattatcgattttttttaccgcacactgactttatgaattatttattcaatttttgcaatatgtatgatctgaaatatctcgtgaaacatttacgagctttaatattttaaaatgattattaagttggaaattgacaaatcaatttcagaaatgaagtctattctacttttattctccctgatagtgctcggcagtgcaacagaagaagtgagcagaactgagcaaacatcgacattattctccgtcgaaggcgaggttcgtataccaaaaatgtttgatttttggattaaaaatatcgatcattttggctatattcatagagaagtcatattataaattaagacaacgtttatatgcttctgaatactttttccagttctcacattttttaaaattttatcttctaggttcctattctaataacaacaaattcgttgtaaattaaatatttcatagtcctcaaaaaaaaaatttcagatcgcacttccatctactcgaaattgtgcaaaatggtccgcaggtgctcgtattcatttgaaccatggccaatatatgggatttgttcgtcaagattgtacattccgtgttgatttcgtgcctactggaacctatattgttcaaatcgaaaatacagattttgtctttgagccaattcgcgttgatatcacatcaaaaggaaagatgagagctagaaaattgacaattcttcaggtatattgaatttcggaacaaatcaaacaatttcgatcgtaaattattaactaccgggagaaaacggttaaaatcggacgtagctcctccgaacgtgtgatgaaaaaatttttttttaatcctctgtttatcatgactgcgtcgtagttttttttgcaaattaatatataaatatagagaaatatttgtaacttctgataaaaattttactttcatttgaaagttttcagaagctgctccaaaactaactaaaaaatatcgatatgccgatcgccatttgacatttgacacattgcgactttgaggcatttttaaaaataaattttcaattaaaagtaaaattatttgcagaaaaacgaatatttctctaaaattttatttgtataaatgtgttataaaaacttggacacaagatgagaaaatgactgttttaggaataagccgtattgtttcgcttcgaatcttttataaaagttctaacttggaaaatatagatatagacattctgtgcagaaaatctcaagaggcccttaagcagttcttctgagttatttgaaactttctttcaatcttcataactttcagccgaacaatgtcaacactctcccatatccactccgtttatcagcacgaggtcctgctcgttacttcagaaaacgtgaagaatggagaatcactgatatgctgttcagtccgatggttttgatgctcgttgtgccacttgttgtcatgctaattcttccaaagtatgcttcctcttaaatcgctcatctgcaaaattccaaattttcagaatgacagcaaatgatcccgaactcaaaaaagaaatggagaacatgcaaatgccaaaagttgatatgccagatgtcggtgaaatgatggctaacttctttggaggat