Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_C35D10.4   

sjj_C35D10.4 RNAi JA:C35D10.4
Simmer:C35D10.4:Repeat_a
Simmer:C35D10.4:Screen
PCR_productsjj_C35D10.4
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSC35D10.4 Source_evidenceePCR978WS150 Sequence/Annotation Release
Overlaps_Gene C35D10.4 Source_evidenceePCR978WS150 Sequence/Annotation Release
Chunk_score (4)
Map_statusUnique_ePCRIII48634944864692
Overlaps_transcriptC35D10.4 Source_evidenceePCR978WS150 Sequence/Annotation Release
WB_DNA_textsjj_C35D10.41199aattgggtatgatggacggagaattgagaaacagataagacgaaaagcattgcagacggttgttatgggaggacaagatgttgacccattgaaggtatgatttaaattttcgaaattttgattattctttgaaaaatgatatacttactccaaaatgtgtattttgagtatttataaatatatacactgaaccaaaaagataaaattttaattttcaatgattttctttttattctgtttttcaacatttccctaatttccatatttcaggaaccaaacaaaaccaatgctccactgctttccccaactcttccttcaacaaacgaagctctgcaaagagcaagagtggttgctgctggaattgaaacattcgccaaactgatgtctcaaggcacttatcctggatcagctggcttcactgtttcggaaacaggcgagagaaaatatatgaaacaaacgtctccagttcaatcgaatatcgttgcgaatctaatggcaactgctgacaaattgagcaaaggagttatttctctggcaccatttccccttcctacaatcactaagctaggaacatgggtgattgcaaatcccacagcacaactgccgattccaccacagctcaaatctgctatcccagcaataggacagattgaaactttgattcagtctattttgggagttcaaggaccagtcagttctgtttctagagctccacgaaagttaaagttagaaggtgtaactgatcaagttgtgttggaacctgaaacaatacacggtaattttcagaaatattcaatcttataaccttatttatttatagcaactgtcgatgttgaaccaattgacaaaacattaacaaaagaagaagcagaatttctcatcaaagcagcaagatctgttgatgacgacaacgctgagacagcaatctttggaactcagaaggcaaaaccaaaagtctaccgaccagagcttccaaaaaactttgaagttaatctagaaatgggaaatgtacatacattgacacgaagtaatgagagctcagtgccagcaactcgtatcggaagacttgctacttttggtcaattagcattcggtcttctaggtggagcaacagcagaagtcactagaagaacatttggaattggaaagaggttacaagaagaaggaattccaaagaatccattcctttcagaagccaa