Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_C35E7.7   

sjj_C35E7.7RNAiJA:C35E7.7
PCR_productsjj_C35E7.7
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSC35E7.7 Source_evidenceePCR516WS150 Sequence/Annotation Release
Overlaps_Gene C35E7.7 Source_evidenceePCR516WS150 Sequence/Annotation Release
Chunk_score Abs_score432
Max_abs_score432C35E7.7
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI1081342610814942
Overlaps_transcriptC35E7.7 Source_evidenceePCR516WS150 Sequence/Annotation Release
WB_DNA_textsjj_C35E7.71517ttgtctttcaattcaaccgagatctggctttcaaagaacagcagtatacatggtgcatcgatcgggagtaagcatctttgttcattgttcacgactaatcttggtttccgttagttttattgaacgaatgcgcactttccagttcttacaagccgaaatgtatttacttttatcataaaaattgctttttactaaatgcaaacttccacatcacattttcattctttgccctgtcaattccaccgtgcaaaactaattaccatttgccagttgtcccatttgaattttgaattttgaatattgaattagctaatatgggagatcggaaccgaataaaagccgatgaaattgaaacgaaaaagcaaacaccatcaaaatgtcagctatcagtcttcttgtccttcttctaatgatctttgccgctcaattgtgcaagaatccacttgaaaatggtacgtaaatcatttaatttagtgtagttaattttataagaaatagcttggttttgttggatactttctgcaaaactctctaaaaatctatataggctactgttttagctagtagtttagcccctaacgtatcctattaaagaaattttgcacaaaaatgtattgacttaaaatttaattttttttcaataaaacaatttctaaaaaatcaccgatataattatggaatatcggaaattcccaaaaatatcgctgaaaaacactaaatatgaactgaacactttcaggagacaattaaaagttctccgagttgagtttcacagttaatatttttaatggaaatttcagttataaatttgcaaatagcacatttcaaagtttgagtatagattgacgcattttttagaaagtagttttgacagggacattaagttttagtggagttttggaaaatcttcgtagacaataataaaaatttgtgtaggttctataatttcatcattttactttcattctggtatgataatgttcaattttatgtttaccagctacttctcagtacttaaaaaaataaaataaaatatatattcggctttccgaaattccctgaaaatttcagaatgcgggtgcatcagacaaccaacatttgaattcaattggcttcaaaccgaatatccagaaatagccaaacaatacaccgaagaccaattccttgccccagtagtcacttatccagaatgcaaatccatcgttaccacttgtccaaatggttattcggttgccggtttcattgttgaaaccaaaaaaatattggtgaactcaaatgtaagtgaatataattgccattaacttttatttccatatattttagatttacccaaatccaaatactgtccttggaataaaatgtgaagctaagaaatggtattatgacggacaagcagaaacctatgatgataagctcaaaattacatttttctcctgcaagaaagactaataatagttgaaactttggaaaatgggattctcgttaatgaatttattttctcagcgctgtctcttact