Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_C35E7.9   

sjj_C35E7.9RNAiJA:C35E7.9
PCR_productsjj_C35E7.9
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSC35E7.9 Source_evidenceePCR747WS150 Sequence/Annotation Release
Overlaps_Gene C35E7.9 Source_evidenceePCR747WS150 Sequence/Annotation Release
Chunk_score Abs_score663
Max_abs_score663C35E7.9
Specificity_index0.825
Rel_score1
Map_statusUnique_ePCRI1080708110808082
F36H12.3 Chunk_score Abs_score141
Specificity_index0.175
Rel_score0.213
Overlaps_transcriptC35E7.9 Source_evidenceePCR747WS150 Sequence/Annotation Release
WB_DNA_textsjj_C35E7.91002atcaccattgctggatggattctcgctggatgtggtggaaagaagaaaaaggatggaaaggtaatatttttaaacgtttatgtatgcttcctaggaccgaaagtttcgtgtcctcggtagtatagtggtgagtatccgcgtctgtcacatgcgagacccgggttcaattcccggccggggagaaaccttttacacttttatcaataaaagctttatttttcagtcttcaacagcctcagcagcggccccgaaagccgatagtaagatgaaaccgcctgtggagaatgtgaagtcgaagaagagtgagaagaaagaggagccgaagaaggaagaggagccgaagaaggaagaggagaagaaggagaaatcgaagaagagtgagaagaaggacgataagaaggaagaggcaaagaaggaagacgataagaaagatgagaaaaaggatgaaaagaaagaagataagaaggacgataagaaggacgataagaaggaagaaaagaaggaagaaaagaaggaggatgaaaaagaaaagggtgatgataagaaggaggacgagaaggatgataagaagagtggtagtaaggatgctgagaagaaagaagagaagaaggaagaggagaagaaggaggaaaagaaggaggaaaagaaagaggaaaagaaggaagatgaaaagaaggaggacgagaagaaggaggagccgaaaccccacagtgagttttacctatgaaagattaacgaaaacttgaaattttcagtcactatcgatccacccggtgatctgatgttcaaggccgatcagcaagagcagaagaagctgaaactcacgaatactcacgacaagaaaattatgttcaagatcaagacttcggataatcaggtttatctgtaagttgtctagactattatcagaatttgatattatattttttcagtatgaatccggtgtacggaactgtcgaaccgggaaaatctgctaatcttacactcactcgaaacaaggca