Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_C36B1.1   

sjj_C36B1.1RNAiJA:C36B1.1
PCR_productsjj_C36B1.1
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDS C36B1.1a Source_evidenceePCR527WS150 Sequence/Annotation Release
C36B1.1b Source_evidenceePCR527WS150 Sequence/Annotation Release
C36B1.1d Source_evidenceePCR527WS150 Sequence/Annotation Release
Overlaps_Gene C36B1.1 Source_evidenceePCR527WS150 Sequence/Annotation Release
Chunk_score Abs_score361
Max_abs_score361C36B1.1
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI87137448714927
Overlaps_transcript C36B1.1d Source_evidenceePCR527WS150 Sequence/Annotation Release
C36B1.1a Source_evidenceePCR527WS150 Sequence/Annotation Release
C36B1.1b Source_evidenceePCR527WS150 Sequence/Annotation Release
WB_DNA_textsjj_C36B1.11184gaaaaaggttgcaaagacagagaaaacacttacaattaaacaaataaaaaccacgcatttgttgttgtcaaatgaatgattcaagagaaagacccaactgatattcaatatccctatttcttctcaatgcttcttgaaaataatttacctttttgtggaaattgtggaaataaatgagatgatctgaaaattaaagtaaaataagaaacaaactaacctcaaatccgttatcgatgattggtcctgcacttgcaatataaagcttctctgcttcatcaaatgagaaatcagggagagaggtaacctggaagaagtatttaagatttataatatatttagttcatataataataatatttttaatcacgttatcatcgatttcaaatttcatagattgagtattataaagcttggattttgtagatctgagcagcgagagtagcaaatttagaagcaaaagtcgccattgaacttggacacaataatttccaatagtcggaaaaatgattttggctctcatattgttaaataattaattactaaaactgtaacctgtcttgatgcaaaacgtctgcatttgaagtaaaatgtgacagtttgatctacaacttctaatgcaaattgtgtccattgctgagagaaatcttcgacaagaaacgatacaattgccacagaacgaactatcagtgaaatattcgtttgctttgttcctgaaaatatttctcattttaatatttttcagtaatcaaaaaaggagtgtctaacctgctggttcaataagcaatccaatatcaactgctgaatcatatgcattaactgcagcaaatagataaccacctcttaaattattaattataattttaattatagagtttgtaaatataataaccgtttatccattggcttgatagtggcaagtagagaaaattgtttgaaaaaatttcgtggcaaatataatcgataagggactgcaatttcaacacctctctgaaaattcgaatattttaaatctaattgaatcaatatcttgcaatttcttacctgtaacccgattgctggcaaagattcaattcctttggctctaaaaacccgtgcgtctgcatttaaagatgctttaactggagccaataaatctacttccgtttcagaatctgaaagatatgagaacattaattccggaaaga