Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_C36B1.3   

sjj_C36B1.3 RNAi JA:C36B1.3
Simmer:C36B1.3:Screen_A
Simmer:C36B1.3:Screen_B
PF:GL1_4F5
PCR_productsjj_C36B1.3
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDS C36B1.14 Source_evidenceePCR61WS150 Sequence/Annotation Release
C36B1.3 Source_evidenceePCR591WS150 Sequence/Annotation Release
Overlaps_Gene C36B1.14 Source_evidenceePCR61WS150 Sequence/Annotation Release
Chunk_score Abs_score61
Specificity_index0.112
Rel_score0.126
C36B1.3 (3)
Overlaps_transcript C36B1.3 Source_evidenceePCR591WS150 Sequence/Annotation Release
C36B1.14 Source_evidenceePCR61WS150 Sequence/Annotation Release
WB_DNA_textsjj_C36B1.31095taggattgtgaatgtgccgagttctgcgatgagtgttcgataccgttcattctgcagatgaaatgtaaagatgaagctactttggctgttactaccgagcatctaatgccaatgcataatttagacacggtaaatttaaaaaaatgcaactcatttttttttaatggagtgaattaaatttcaataataatattaataacgtttaaataaaatcgatgagcaatcttattagggtccgtacttcactacatttgataaatatttgaattggaattttacagaccgtccgaccagcttgtggaaaagcactacgtgagcgtggatcgacccgtgacgaatttcacaacagagaagagattctgattgtaaaattgcgtaagggacaagagcttaacctaaaagcctatgttaaaaagggtttcggaaaggaacatgcaaaatggaatcccacctgtggagttgcatttgaatatgatccagacaatgctctccgacatacaatttatccgaatgttgaggaatggccaaggtaagaactattatcagtattttgtgaatttcgtacattttttttgcagaagcgatcattcatctttaccagaagacagcactgaaaaggaggcaccattcgagccggacaacaagcctaacaagttctggttctctagtaagtcacggtcagatattttgcttataattttaaatgtttcagtcgaaggaactggtgctcttccagcacagcgaatcgtgacaatgggaatcggaatcttgaagagaaaactggaggaactaaatatggctctttcaaatgaacttcaagctcatgcccagcagcagtaaactatttggatctctaatttatttacgttattattaactcttctcgttgattttcgtatctctcctgttatcatgaatgaattaaatttgattgacaacctcagaatgtttctacaacatgtcgttcgagcatcttaatatttcattttgtaaaaaaacatacatcttacaatacggcttttttttcgcagaatatggtgtgtggagactgtgagaagaaacttacaaaaatcgtcggagttgatccttaccgaa