Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_C36B1.7   

sjj_C36B1.7RNAiJA:C36B1.7
PCR_productsjj_C36B1.7
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSC36B1.7 Source_evidenceePCR510WS150 Sequence/Annotation Release
Overlaps_Gene C36B1.7 Source_evidenceePCR513WS150 Sequence/Annotation Release
Chunk_score Abs_score429
Max_abs_score429C36B1.7
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI87360278736855
Overlaps_transcriptC36B1.7 Source_evidenceePCR513WS150 Sequence/Annotation Release
WB_DNA_textsjj_C36B1.7829tgattttcccacgattcattatctttatcttcgaaatctgtattgtttgaagatttcagtcgatacgaagtcgaatggaagcgtatttcaaatgtgcttcgttttgctgtgcaaagttctcattacccgtttttaaaattttctctggtatctcaatcgagttattttctatttctaggcattaaaaatgagaaaaatgaacttaatagtggctatggatgccgaaggaggaattggcaaaaatggcgtgttgccatggcgaatcaagaaagacatgcagtatttcgcgtctgttaccaaaaatgtttctgatcagtcgaaggttgttcgagatttctaactaaacttgtaacataacttttgtagagaaatgcagttctcatgggacgaaaatgctgggaaagcattccagtaactcgccgcccgttggcaggacggctaaacattgttttgagccgacaacttcctgcgcaaaagtccgatgactacattgttgtgtaagctgtcatgaaataatatttaacctgttgttgttacattcagaaactcgctcgaagcggctatgaaactactttcggagccaccatttgtggattcgatcgaaacaatctggaatatcggtggagctgaaatctatgatcttgcgttgcgagaaaacttggttgatgaaattcacttgacacgtattttcaaaaagtagggtgcttgcacagtttttttactctgtcgtaatttcagcttcgaagccgatgttcatctcaagtcactcgatttcagtaaaatggagaaagttcaaaatgccgaggtgtcatcggaaaattcagaaatt