Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_C36F7.1   

sjj_C36F7.1RNAiJA:C36F7.1
PCR_productsjj_C36F7.1
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSC36F7.1 Source_evidenceePCR707WS150 Sequence/Annotation Release
Overlaps_Gene C36F7.1 Source_evidenceePCR707WS150 Sequence/Annotation Release
Chunk_score Abs_score647
Max_abs_score647C36F7.1
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI95390219540623
Overlaps_transcriptC36F7.1 Source_evidenceePCR707WS150 Sequence/Annotation Release
WB_DNA_textsjj_C36F7.11603gttgtcaactcatctgatcctccagatcctcccgaaggcgttggtgatgctagatgtggctttccgaatagggattctccttttctttcggaatttatggatgttgagcttgatggacggttcatgtcatcatcatcgtcgtcttcatcgtcatcacaaccatcgcctcgtcgattttgtggtgaccaagtcatcttgttctccttcttcagtcgtcttctggcgttagcaaaccatgtcgagacctgtaattaaaaatataaatttcaagcttcggctttgtttttcgggctagagtttattttaataaaataacttcaaagttttggttcaaacaattttaaaatctaatttttggcgccaaggttgtgtgttgttggtctattgcaacaaaatcaaacaagtagtagccctatttggtttgaaacatttctcgtattgtgtaaagaatgtctctcgaaacacattaattaagcggggtacgaggtgtcatcatcatcgcttatcgcctctgtacatcttttgtttctcgcccctctttttttggcatcggtcaaaaaaggagacatttgcccccggggtttgatggccggtgagtggctaatgttacaataacactgcgggaaacactgtctactacattttacaacaatattttttgtggtatttgtaattgatgactagaggcggctctaaaatcccgtgtgagctaataaattgagcaaatattgtggagtaaattacgagattacggttggtaataggctattacggctattaaatcatttcacagtgttgcatttactaattgttgtcaaaacaagaaataatacaacatacctgtgtaagtgtcattcctgtaccaactgccaacataactttatcagcttttgatggatatggattctttctatgagaatgaagccaatctttgagtggtgcagttgcttctcgtgttgcatttcttttcttgattccatctaaaccatatggatgatataaacgatgagcatcactgaagaacatgggcatcggtcctggccctccacctaataacatttctggtttcagatctgctggaattccatgtggaaacatcggaactccggggaagccagcaagagttgcttgttgagcggcggcggcggcttgagcttgagcagcgagaacttgagccatggcaggatggaaatgaaattgacctaaaaggtttggtggcagaattccgcgaagtgcatccggagctgaagtgggtggagcaggagtcgttgtttgtggtgttgtgggctcttccattttgacctggaaatggatttacttttctagtcaggtgaagtgaaggtatccaaacgaataaatctgacatttggcatctaaattttttggaaggaagtattttgagactgtgttcaaatgttgtctaatctaagatttatgtaaaaattggtaggaatcgaaaacgaaaaccttgtccaagctttgacaacttctcaactgcaattttctatattagacttgcacccccctcttccttcactttgacagtttatatctcagttctttgtggttttattaaaaaacttcaaacggacaatttacttgc