Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_C37A2.2   

sjj_C37A2.2 RNAi JA:C37A2.2
Simmer:C37A2.2:Screen_A
Simmer:C37A2.2:Screen_B
PCR_productsjj_C37A2.2
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSC37A2.2 Source_evidenceePCR1100WS150 Sequence/Annotation Release
Overlaps_Gene C37A2.2 Source_evidenceePCR1100WS150 Sequence/Annotation Release
Chunk_score Abs_score1058
Max_abs_score1058C37A2.2
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI67935296794704
Overlaps_transcriptC37A2.2 Source_evidenceePCR1100WS150 Sequence/Annotation Release
WB_DNA_textsjj_C37A2.21176acatcacaagaaaatccgagagatatacgatcattgagccatcaacttccaatgattccgccacagcaaccaccacctccacaagtgccttcacatatgctaccatcatctacgggacaaccaggtcatcctagtcatcacatgggtcctctatctcagcaattactgccatctggacccaaccaagggcatcacagttttcaagttatggttaagcaagaaccaccatcacagtttacacctcaaccacatccaatgcaacagacaccacagcagcaggtactgcctcaatatccacccggtatgcaaccacatcaaatgcatcagatgcgtcaaatgactgcagaagaatatgcacaaatgagagcacgagaaggattcatggctgcccaaatcaaacaagaagttcctagtggtagtggtcagccaactcctgttcccggaacaccacaaccacaacagatcactccacagcctggttcattggggccaatgggatcattgggacctccaactgccccacctggatcacaacctatgaatccacaacagcaaaggatacagcaacaacaacaggcagctccgtcggcatcaaatagcccacttcttgttaacttactttccaatcagcagccacctcagcaacagtacatgtatccgggaccatcggctcaagggctcagtatgcagcagattgcggcaatacaacaacagcagcaacatcagcaggttagtactattagtttatacgttcattccagtaaatgttataattcttattcacaaaatacgtgaaaaattacagtaccagcaacgaatccttcaacagcaacagcaacaagcaatgatgcaacagcaacaacaacaagtacagcagcaacagcaggccccaccaccaactactccgaatccggggcatcctcaaggattctttccgacgaatcaggcaggtccgccaggaactccgggacgccccattcctccgtatgcaatgggtcaaccacctatgtatcatcaagctggaccacaaggacagatgattcaacggatgaattcttatcctggtaatgcacagcagtttcgtccgcctccacagcagtcacaacaaccgataccaccgcagcagcagcagcaaccacctgcgcctcctcaacaacttcaacaaccacctgtaca