Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_C37A2.6   

sjj_C37A2.6RNAiJA:C37A2.6
PCR_productsjj_C37A2.6
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSC37A2.6 Source_evidenceePCR761WS150 Sequence/Annotation Release
Overlaps_Gene C37A2.6 Source_evidenceePCR761WS150 Sequence/Annotation Release
Chunk_score Abs_score656
Max_abs_score656C37A2.6
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI67879336788985
Overlaps_transcriptC37A2.6 Source_evidenceePCR761WS150 Sequence/Annotation Release
WB_DNA_textsjj_C37A2.61053caaagttccgatgcatcctttgtctgtaagactttggagctcctagattgtcctggaatgattttctttccgttagaggccagttacaatagtttctagtaaagttcaacaattttattcctgaaagactaattcagtttaaatttaacagttattggaattttaattcaaatactttcgcagtattgaatccgtaatgttccttaatgacgtatcctggaagtgaaaactcggccaattgatttttggtgaacttcgttttgtatctgtaaaccgaatttatgaggttatgagaaacattttctatttgaaaatgaaattgcaaagtattcaccgttgcaagtattcggattcggctagtggatgacgatcggggtcaccaacaagtactctgaccatatgtgcatcttgaattctgtagaatttaattatatgtttttgcaccaattttgagatattcctactttttaagccacgaaaaaagaagttcagcaaagtcagaatcgtaaaacatgtcacctaggagaatgaattttctgatatttttggagtcagtgaaaaattgagtggacattctttcatttttatcatctaaaaaattgatcgaagagtattgaatctttgaatctcttaaattgttcagatggaaattgagcttcgtggatagaagtgcatctgaaataagtagctcattctacactgattaacttcaatctcaaaaacaaacatctatcaatgtcgtttgctagaatcttcttcgctccacaaatagaagcagatatcgaggctgaaccacagccggcgccgaagtcgacaatttctgatccttgaaacaaaggtttattatcaagaatgaaccttgataggccttggccgccaggccaatagaatgcccaatagggatctggaagaggacaagcatcgggagtgctcatccacagtggactagcaattgtaataagatgaagattgatttctggagttagactttcattgctaactattgtatttcgaatcatccatttcgcagcagcatttaggctgggcttcaac