Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_C37A5.8   

sjj_C37A5.8RNAiJA:C37A5.8
PCR_productsjj_C37A5.8
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSC37A5.8 Source_evidenceePCR270WS150 Sequence/Annotation Release
Overlaps_Gene C37A5.8 Source_evidenceePCR270WS150 Sequence/Annotation Release
Chunk_score Abs_score228
Max_abs_score228C37A5.8
Specificity_index0.486
Rel_score1
Map_statusUnique_ePCRI1415719714158167
C37A5.5 Chunk_score Abs_score144
Specificity_index0.307
Rel_score0.632
C37A5.6 Chunk_score Abs_score97
Specificity_index0.207
Rel_score0.425
Overlaps_transcriptC37A5.8 Source_evidenceePCR270WS150 Sequence/Annotation Release
WB_DNA_textsjj_C37A5.8971ccacaatggaaataacttcaaggttatccatatatactgcatacatatccacaatattatgaggtttctctaggaaactgaaagaatcctagtgtttgaatgtgttgagcatattaattttaagaagccaagaaaccataacttctgataatgactgatatctaggctgtcacgagggttgcttaaagtgttacagttgtgccagtaatattaatagctcaatttctacaacatacaaaccattatggtaccctacaaacactacaaatggtttgaaaccttgttgtttattgtttttactgaactcttatccacctgatacctaaaaaacgtcatgttaagagaacaacaccgcccattttgaatcctttataaccactgggagatgaccggatttccaagtactcgtagttctaaaaacctttaaaaacccaaaaaaaagatgaaattcgtttctctattcctccttgccatcctcgccatcggagctctttccgacactgtcaccaccaccaaaatgaagatggaaatgaagccagtggctatgccagctcagcatcaaaccgagatgcattctgaaatggactctgaagctccgtaagtgtcacaatctgaattaccggctcaaaatcctaatttcagacacacccgtaaccgtcgttggggatactatggaggatacggtggatacggtagaatgggatacggtggatatggaatgagaggatacggttatggatacccaatgtggggataaacagtgacaagggaccaatatactttttcacatagaaatgtgtgttttttgtatgactttaattgtataattatgtaaaaattgaatataaatattgtatcttcctgaatttttttttgttgaagagtttgaattgcacctagattggaaataaatcgaggtaacatgagttttattaaataaaggcggagagccgaaatctgagacttttctt