Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_C38D4.3   

sjj_C38D4.3 RNAi JA:C38D4.3
Simmer:C38D4.3
PF:GL1_3E12
PCR_productsjj_C38D4.3
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSC38D4.3 Source_evidenceePCR889WS150 Sequence/Annotation Release
Overlaps_Gene C38D4.3 Source_evidenceePCR889WS150 Sequence/Annotation Release
Chunk_score Abs_score763
Max_abs_score763C38D4.3
Specificity_index1
Rel_score1
Map_statusUnique_ePCRIII47903964791527
Overlaps_transcriptC38D4.3 Source_evidenceePCR889WS150 Sequence/Annotation Release
WB_DNA_textsjj_C38D4.31132gcctcaaaacgaatctctcgaatcgtctattaaactgcaggaagagttacaggaagagcctgacatagttccgacaggtgatgaagataccgcggataaagttcaagaacaagctgttgaggaagatagaccaccatctgtaagataccataaaataaaatttgaggaaaaacggcaataattgtatatttcagagaaacactcgctcatcatctgtccagaagtctacttcacaagtggaagaccgggatccgaaagaacttgtcgaggaagaaagacctccatctgtcagtttcgtcatcaatttgacagacagaaataaaatttatgttttcagagaaacactcgttctgcgtctgttcaaaaatcatctaaccaagagaaaacttcggaatcaggagaagtcacggaagaagatagaccaccatccgtgagttgtttttaaaatttgaaatttatatgtgtatttttctagagaaatacgcggtcggcatctgttcaaaaatcttcatcaaaggtaaaagaccagaagccagaggaactcatcgaggaagatagacctccatcagtaagtctctcgtgatttctttaaaaatttagttcaatatttccagagaaatactcgatccgcatcagcccagaagacagtggcagcaaataaatctgttttggagtctgaaattccaagtcgttcagcgtcacgaagaactcgctccacatcgcttaggaatgatactgttgccgaaccagatgagacgtcggttgcgatgacaactcggcgtcggactcgggcaacttctgaggttgttagcaagcagtcgtctgaagatgatggaagatcgacaccaaaaaccggaagaactcccacgaaaaaggctgcagctagtacatcttctagtagagctggaagtgtaactgtacgttgtttaatcgtttaatcatacaactattcgaacattttcagcgcggtaaaaaatcgatcatccaaaagatgccatccccgctagaggttacaatggaagttcaagaagaagaagaagaagaagcggaggaggaacggcctgcatcaagaagcactcgctctgcatctgtcaaaaatacaactgttgacccatcgtcatctgcacttgct