Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_C39E9.14   

sjj_C39E9.14 RNAi JA:C39E9.14
Simmer:C39E9.14
PCR_productsjj_C39E9.14
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSC39E9.14b Source_evidenceePCR889WS150 Sequence/Annotation Release
Overlaps_Gene C39E9.14 Source_evidenceePCR907WS150 Sequence/Annotation Release
Chunk_score Abs_score802
Max_abs_score802C39E9.14
Specificity_index1
Rel_score1
Map_statusUnique_ePCRIV1309762013098712
Overlaps_transcript C39E9.14a.2 Source_evidenceePCR898WS150 Sequence/Annotation Release
C39E9.14a.1 Source_evidenceePCR907WS150 Sequence/Annotation Release
C39E9.14b Source_evidenceePCR892WS150 Sequence/Annotation Release
WB_DNA_textsjj_C39E9.141093gagctgcactggtaaaagccgtgccaaaagatcgatgtacaatgtacttttggaggagctgaatatttttagtctcttttgcgctggtgaagacaagagtcgctccgagactgaggcagaattttctcagttgaatgctgatcttcgcgaattgagcatctgtgaattcctttcctaaaacttttgcaaacatcatttattttatttttctttaaataatatacccaggtcagatttggtaatgaccaccatgaacgtgactccacagttctcagtaagagttccttggtcgagaggaagaaggttgtgctcatcggcgaaacttccaactacggaagtgctcatttgtgattgaaccggatccacatactcttgccacattttttcttctggaaaaaattattttaaattgcatgaagtaaagagtttataagcttacgttgagatctaccggctttcaagtcttctttggtgaaatgtttctgagcttgctcggtgcacacatttgcccatcttttcaaggaatgaatgagatctgaataattaaatacttatttatttgaatatataatacttactcggattatcaatgctcgcggtaagaatgaagatagcttccgcgggagttgctggaagagcatgtttcagaagggaagcacacgccgcattcccatccaaagaccagacagggatttgaagcaactctgatggattgagattggctccggctgttcccagttgatatgcataactggcgtcacgagcatcattttgcacgtggagcacacgatatccaagtagtgattttggcttcacggttctatcagatttgtccagacgggaaagaagagacgactttccgcttcggttgtcccccagaacaatcaccgtgctgccttgattcgtgtttgtctttttggaagcaaggagctctcgcctgaaatatgattttcaaatagtatatttcgtaataatacaacaaataccaaattccgacttcttcgtctgtcgaagaatacaaaaccggaagcacagcatttgctgtatcatcaaactccagtggttgcgcagttggtggcattttctcgaagaa