Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_C40H5.6   

sjj_C40H5.6 RNAi JA:C40H5.6
Simmer:C40H5.6
PF:GL1_7D7
PCR_productsjj_C40H5.6
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_Gene F59E12.5 Chunk_score Abs_score108
Specificity_index0.093
Rel_score0.258
C40H5.8 Chunk_score Abs_score418
Max_abs_score418C40H5.8
Specificity_index0.359
Rel_score1
C40H5.6 Chunk_score Abs_score382
Specificity_index0.328
Rel_score0.914
F59E12.4 Chunk_score Abs_score171
Specificity_index0.147
Rel_score0.409
C18E3.2 Chunk_score Abs_score86
Specificity_index0.074
Rel_score0.206
Overlaps_pseudogene C40H5.6 Source_evidenceePCR445WS150 Sequence/Annotation Release
Map_statusBest_ePCRX1177512011776131
C40H5.8 Source_evidenceePCR386WS150 Sequence/Annotation Release
Map_statusTop85_percentile_ePCRX1177512011776131
WB_DNA_textsjj_C40H5.61012tgaagaaagggtggaaatgcttggcttgcgacgtgttggatggatcttcacagattgttggacagcttatagtgctgaagaaactgtacattatacaaagcacaaggtgagaacaatctagaagagaagcccaaaaaacgaataatttttcaggattccttcttcctatcagctgaggagtgcatcaccgcagcaatgcttcaaaattaacatccaagtactcgatggatcgtcactatggatccaaaattggcttatgttcgagaaacaccattatccgaagaaaattatataactgatgttcaattttcgatgaaaaatgagtatggagccgaggttatgaagcacggacgaccacttccagttgaatatttgctggtggatgttcctgccggaatgccaaaagagcctcactacacgttccacgttggcacatctaataaatcgaagagtgccaaatttaatgttgaaaatcgacaagcaattggacaacttcaaggatgtgcaaatttgattcaatactcatccgaacctcgaatggttgcaccgccggcggctccattgccgaaaaagaagaagtatgcggataaatgtattcacccaaaggtttttatttattcttttgtcggaaatttaaatttttaattttcagatttgcaatctcgagccagacgcagaaaactacatggcaatcctggccgaagctttgaaacgcccgagtaaagccaagaagcgtcttcgaatttacatttcacacacttttatcgaagagaggcaaccggagcaggataccgatgaagcttctcttccgatgtgggaacttcgtgtcgaaggacgacttctcgatgagcagcctgcggctcctgctattccagagtgaatagaatgagattaatggaagtgatttatggaatgatattcaaactcttgatcaaaagtgttatgatattatcgaacagatcaacgaactgaaggctcgccgcgatttctacgcaagattctacaccgagcc