Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

Oligo: sjj_C41C4.8_f   

sjj_C41C4.8_fSequenceCGTTTAACCATGGCCTCAGT
In_sequenceSUPERLINK_CB_II
PCR_product smd_C41C4.8
sjj_C41C4.8