Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_C41D11.1   

sjj_C41D11.1RNAiJA:C41D11.1
PCR_productsjj_C41D11.1
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSC41D11.1 Source_evidenceePCR773WS150 Sequence/Annotation Release
Overlaps_Gene C41D11.1 Source_evidenceePCR781WS150 Sequence/Annotation Release
Chunk_score Abs_score655
Max_abs_score655C41D11.1
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI44572944458437
Overlaps_transcriptC41D11.1 Source_evidenceePCR781WS150 Sequence/Annotation Release
WB_DNA_textsjj_C41D11.11144gcagacttgctgcctcttctctgaaaataattttcgccgcatttttttatttttcaaataaaaacatctatttaaattatttgttttcaggtaaaaatatgaccgataaggagaatttctactcgggattctttcttggacgactgccaggctcatttgacagccgatttttgattaaagtcgcctgttttcagcccggaaaagaggaaagaaatgtttttgagcttacaacagatacaaagagagaagaagattatggagaaatggtgcatttttgggtagagtaagtttattttcatttttctaaagttctaaaaattaattatttcttttataaattctatttttcagcaaaggacctctccagaacaagtcattcgtccggtttgaagagaattacgagactttttttattcatgagaataagatgtttgacagaatcgtggtgagctacaataagagcttaaaaactgaaaataatcgattaatttccagcatacggataaagatttttatgttggagtcaacgaccttccagattcagatatctacatacatccagatttaggaaaaatgattgatacccgttcaattgtgacgccgggaaagtatgttgaaaatattcgcttttacaacgaattgcaatgaaaatttcaggaaatacaactttatcactttcgaggtcaaacagaatgaaaacaatagttttgatattgaaattgttggtggagaagttcagggaaaagaaaagaattctgaagagccatctgccaaggaaaaaataattcaaaaaatggaacaagttcatgaagtgatgaaagtagagtatgagtacaataaaaatgtgagtgttttcagtgaaaaaatttaaaaaattaaaaaattcggtaatttattcaggaagaaaccgcgaattgggatgtaatcggacatttgaaactcatcaaattttatgacaaagatctcacatctgggcttcgtcctgtactacggcttatggataatagacacgttgcgttgttcaagaagcagagagaaagtaataaaaatgaatatttattttatttaaaatgaaataataatttacagccatgccaatcaagatgatcaaagtgattgaagtagacggaatttggaaggatga