Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_C41D11.2   

sjj_C41D11.2 RNAi JA:C41D11.2
Simmer:C41D11.2:Screen_A
Simmer:C41D11.2:Screen_B
PCR_productsjj_C41D11.2
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSC41D11.2 Source_evidenceePCR604WS150 Sequence/Annotation Release
Overlaps_Gene C41D11.2 Source_evidenceePCR639WS150 Sequence/Annotation Release
Chunk_score Abs_score576
Max_abs_score576C41D11.2
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI44453634446292
Overlaps_transcriptC41D11.2 Source_evidenceePCR639WS150 Sequence/Annotation Release
WB_DNA_textsjj_C41D11.2930tgctcttgatctcgcttcaaagaatgactggagaccagaattgtatggtttttgagtttaaaaatatatttgcaaagacatatcttttcagggtgaaagccgctggtttgacataccagaacatgttcgaggagttgccaatcatcatcaaatcctcatatctcaacaatgttctcatgtctgagctttcactcgctaaatcatgctcttctgacaagtactccacgagacacttcgatttgggatccaagaagtcgcttgaaaagtcggtccgagctatgatggctaatgttgatgagctgaacaagtcaattcagtcgttgacgaagtacactattgacaagcaaagacatgataatatggtgttcagtctgacgcagaaaagagtaagaatttcgaattttgaaattaaaaatatcctgattgtatcgctaaaatttatattccgaagtgtaacggctttcaaacctaaagtcttgttttttgaaaaccattttccaacatatcgaggctccactaactataaaaccggatgtgaggggtacattttcggtggaataaaggtgccattcacgattttcgaaaaaaaaatctctatcattaaaaatttatatttttccaatttcagcaacaggagaacgaatcacgtgtggcccgtggtgatccaacaattccaatggatgacatcaagagaatcaaggctccacaactccaaacaagaaatggacttttggatgagcttctcgccagttttgacaccaacgctctcgctgacttctcgaagactgtgaccagcgaaaatatcacgaaaatgttcatcgctgaagctgttgctgaggagaaagtcgccggaacaaaagacagaactttgagctctgtctcatcgactcgttaagattcccaaatatactcgtgtttttgtttcctccc