Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_C41D11.4   

sjj_C41D11.4RNAiJA:C41D11.4
PCR_productsjj_C41D11.4
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSC41D11.4 Source_evidenceePCR802WS150 Sequence/Annotation Release
Overlaps_Gene C41D11.4 Source_evidenceePCR802WS150 Sequence/Annotation Release
Chunk_score Abs_score718
Max_abs_score718C41D11.4
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI44418084443983
Overlaps_transcriptC41D11.4 Source_evidenceePCR802WS150 Sequence/Annotation Release
WB_DNA_textsjj_C41D11.42176tctaccaattgacgacttccagttccataagtttgagcgattcgttcagtgacagcccttggattaaatatcgttgatttgaacttccgcatcggggttgacattgtgggagttggtactgctgaaattttaagagttatagagaatgtatatttaaatttaaaatttttttgtgaaaattttgaaaaaaagaaaaccttattttcaatatagtgatgcaattttaaaacaaatttccgaaaataattgtttctcgcatgaataagttaatatttagctgtcacttcgcattattttggtactttttggttatttctgtgaagttgcaaagtatggattttattttaaatattttaaaagatgtgacagggaaacgtttttttcttaattatttaaaaaaaaacggaatattttttctgcaattttttttaaacatgcatgtctaatattttttctaaaaataaaaaccatcgtttgccagattttcatattctgtttcgcataaaaaattcaataaattgtaaaatatcgaatttttttcagagttttaggaaatttattccagattatcgagtttctttcggaaaaaattgtgaaaatttgacaaattgtgtgttaagaaaacataaagaaaaaaagaacaataaaaatagccggaaaacgcaaaaatttcagctcttttcatttttttttcttgaaaaatctaaaaaattctataggtatattgaggctattttctattattcaggatttttaaaacatatttatgtttattttttttcaggctttcataaaaacctttttcaatttccttttcctcttcgagccgaatcgaaaacgacgagatatatcgttttttgaggggacttgtcgaacgattttccgaatcttgacgaactcgttttttgattggcgaagttattggctttttcgtaggtgattttggaacgaacacgtcatcatcgatggtacgggtctcagaaatgccacgtggacgtaaacgttgtggagttaaaattggtggcatgtcggatgaaaagagacactgaaataatattttttgttattttcagaaactagttttatatgattgggcggcaaacgattttttccggcaaatcggcaaatcgccggaattgaaatttccggcatttcggcaaactgtgctgttgcactttttattggaaacttcagaatttcaagttaaagacgcgaaattgtacgcctcctattacgggaacacaaaattctgatgatgcgtatttcacaacatatttgacgcgcaaaatatctcgtagcgaaaactacagtaattatctaaatgactactgtaggtcgatttaagggctcgattctcgaaatgaattaaaattatttattcatcgatagatatttccaaaatcaagcccgtaaatcgacacaagcgctacaggagtaatttgatgaattactgtagttttcgctacgagatattttgcgggtcaaatatgttgtgtaatacgcgttctcagtattttgtgttcccgtaatataaaaaaatatgttcctacttctattttgaaaagtaaggaaattctatgaaaatatctagaaaaacgggaaaacatttcagattgccggaattgaaatttccggcgaatcggcatttgccgaaaaatcaaattttcggaaattcgccgaatttttcgaaaaaaaatttgccgcccagctctgatatgattcagttgaatatattaccgttaatgaagatgttctcttcctctttaacacaggagttaagctatttccaatttccattcgtattggaacatcaagggactgggcctctaatcgtggcattgacccggatcttcggtatcttttaactggagaaccaggtgtttccacatcttcttcttgccttcgaatcctttcaggcgtctgtctcaacagcattgatccactactagatcgacgcattggcggtgttacttgatcttccaggcttggaatactctccggagccagttttcggatcggtgtctggtggtcctgttctatccgcaatggaaccattggctttttctccatttttatgggtaatgcactagtctttgttcgagttagactaggtacaccggctcttttgagactcgctgctacagaaaccatcgatgttgaatgggataggaaggat